WAKE AND BAKE EVERYDAY

2011-07-19T13:10:00.001-07:00

REMEMBERS- Tikal: Jaguar Pants born in Tikal exact date unknown but rumored to be around sometime of the long count 9.15.10.0.0 dated definite much later of after than of the timed rule of Foliated Jaguar much later than Toh Chak Ich’ak the True great Jaguar claw and the war he waged against Waxaktun most likely born around the time of Wak Chan K'awiil or else Yik’in Chan Kawil and well before the cities fortune began to change before the rivalry with Kalak’mul that weakened their hold their temples sacked their kings decapitated waxen bloodied heads paraded around as trophy on Ceiba stick no the Tikal Jaguar Pants was born to flourishing cultural and economic so as for his earliest memories although scarce to be always positive mostly saying he just remembers the people and their telling stories of the old kings telling of Fire Is Born passing through El Peru and arriving in Tikal the invasion by Teotihuacan and of the prophet of Jaguar Mittens said to hold in his eyes the green blaze of a thousand leaves of Belize shoreline and all he told of the calendar priest Jaguar Smoke supposed to have been born by an exhaling of the Bicephalic bar the sky band the ceremonial double headed and of the hushed paranoid whispers of Kawi’l the Manakin scepter God K of the Morning Gloried North sky white K’ul strewn and dew descended of obsidian black skinned orb flesh Flare God or else not or else southern Lamate’d morn of Venus glyphed dawning the sacred statue and the spirit presided within of the mirror in the forehead with it’s cigarette lit and the smoke that billows forthright telling of it’s own Kawi’l of Kawi’l scepter in dried dirt of ruin or moist mud of pre of sun dial or grave marked made like ash of Kawi’l on mirror of sooted as dirt-snow like old newspaper washed reading read gesticulating gibberish all gibberishier than yester of placing Jaguar Pants’ birth sometime in the late 700’s maybe earlier maybe mid century saying he doesn’t have too many city memories from early life a few times maybe spending the afternoon at the marketplace for the Long Count ceremonies the ancestor rituals and dancing of the carrier Jaguar accompanied by the drinking of Maize beverage listening to the families singing the words to their favorite song The Jaguar Came Tumbling Down The Mountain an old folk song telling of a young Jaguar not much younger than he and that he lived atop a mountain all alone and who wore a false beard blonde and long drinking only rainwater and eating only Pinkberry toppings not wanting to come down made his toilet there as well and kept jars of his piss all around where he slept under cosmic magic milky banded not caring to do much of anything save to walk and to strut till one day of when the Seated Jaguar Gods of the geared and grinded calendrical wheeled as bitch-dog is turning fucking to birth of Kins and Tuns bred like pups sat says has had enough debated barely till deciding useless so as to toss his ass down off those peaks and of course tumbling the whole way down just as the title implies and that it was a long and painful tumble hence the format of the song beginning with a chorus chant everyone singing together THE JAGUAR CAME TUMBLING DOWN THE MOUNTAIN THE JAGUAR CAME TUMBLING DOWN THE MOUNTAIN THE JAGUAR CAME TUMBLING DOWN THE MOUNTAIN and then just the children OH HOW DID THAT JAGUAR TUMBLE HOW DID THAT JAGUAR COME HOW DID THAT JAGUAR COME TUMBLING DOWN at which point with everyone taking turns singing verses most made up on the spot the whole thing a free challenge to see of who could sing best the Jaguar’s pain open to all but seen as contest for poets of all type and ages and the people of course always asking Jaguar Pants to come and take a try sing a verse and with Jaguar Pants being a Jaguar and all you know yours would probably be great of what insight you must have into the whole thing What could go wrong they’d say and Well come on what’s it like old fellow a little window to the Jaguar life please but no no he couldn’t do that a bit shy then and also something of a perfectionist couldn’t bring himself to sing it if the moment didn’t feel exact and no this would never work really and the people being good natured of course let him off the hook yet still they couldn’t help asking questions can’t blame a person for being curious can you and why wouldn’t they be I mean consider the times then people in Tikal and beyond having such a starkly bi polar relationship with the Jaguar and it’s kin like of one moment such as absolutely worshipped and the next to be slaughtered sacrificed or hunted their pelts skinned to adorn the rich and noble even then the tendency of humans to comprehend beauty by turning of to symbol or currency contrary opinions abound of they’re an emblem of power and strength is what they are and denizens or citizen keeeprs of the realm of the dead’s all they’re good for but consider how far they had come together man and Jaguar companions through out history’s voyage like of the Andean cultures formed Jaguar cults disseminated by the early Chavin and accepted over the majority of Peru by 900 BC consider the Olmec with the distinct Were-Jaguar’ motif as popularized through pottery sculpture and paint alike take to heart as well of the Jaguar rulers named and seated all ascended to power during the classic period of Lady Une' B'alam K'uk' Bahlam (Quetzal Jaguar) Kan Bahlam (Chan Bahlum I, Kan-Balam I) K'inich Kan Bahlam (Snake jaguar, Chan Bahlum) B'alam Nehn (Jaguar Mirror, Waterlily-Jaguar) Tzi-B'alam (Moon Jaguar) Chan Imix K'awiil Yuknoom Yich'aak K'ak' (Jaguar Paw Smoke, Jaguar Paw) Yich'aak B'alam (Jaguar Claw) Itzamnaaj B'alam Ucha'an K'in B'alam (master of sun Jaguar) but most people when they see him of course asking first and foremost where was he from who were his parents what about his mother his father and what did they do how did they walk but the fact still remaining to this day knowledge of his parents father or mother is spotty at best if he ever even had them like that there are those who hush whispers of believing Jaguar Pants to be born simply of the city itself Tikal the place of voices the city at the waterhole of the first Mutul with earth as womb and the parallel limestone ridges forming of the topography like labia nurtured sweet by sky umbilicus of interweaving snake framed snouts like stamen of sak nik white flower merging and saying he crowned during a thunderstorm was squirted to a clay bowl a represented cosmic hearth and in the violent first moments of his life as ordered by the cities government of to be taken to mountains top of ranged in the highlands left under guard of a panel of seated Jaguar God’s and to be tended and nurtured there by a Lady Jaguar Priest of whose name is lost forever but by most accounts a beautiful and kind woman and that she fed him from her own breast milk sugared as the Rio Dulce the sweet river sang to him every morning and night his favorite song of The Jaguar Came Tumbling Down The Mountain every transit of Venus as well singing this to him holding him to her with baby Jaguar head against tummy as pillow with Venus above blacked by white to Obsidian sun speck and that it has even been suggested of this Lady Jaguar Priest that she was the first to call him Jaguar Pants to christen him so prophetically seeming perhaps you think a bit unlikely well keep in mind then that there is an alternative story of his birth as well that probably it should be mentioned here too though its ending also placing him up on that same mountain and with that same Lady Jaguar wet nurse and oh that it says yes he was born of a human womb and crowned in a hospital room emerging from the dilated Lamat sign of stubble maybe not even stubble though maybe actual hair black and long everywhere and every knot knotted up and spread grown all over growing on his mothers thighs and shit flecked with pregnancy spoils and that the story says yes he was lifted out of wombed fruit basket all pomegranate tealit as by doctors to be placed in antiseptic cradle basked in light from the for some reason red tint bulbs his umbilical cord tended to by nurses uniformed eggshell white and severed in sections by their baby hammers and railroad spikes driven into and torn apart with baby Jaguar Pants screaming and circumcised his little Jaguarius peen slit a long yellow beard on a string tied around his ears and hung from his face fed immediately a formula of plants and root all with starting of the letter C Calabash Ceiba and Coconut (milk and meat) crumbled Cashews and sweet Cassava something in it though getting him to feeling funny getting him as stoned beyond compare though not knowing what stoned means yet he did and as is too to function can’t operate can’t handle his shit and actually maybe it had been that Cassava some of it of the poisonous variety after all or maybe this just being the kind of thing that happens when you eat plants a risk taken either way deciding he had to get some air drink some water out of the sink maybe some kind of relief kind of wanting to lie down but before that could happen he was being lifted again the doctor carrying him across the room nurses tying one more umbilical cord to his waist just a rope a fakery this new one its other end tied to the cradle and he is taken across the room to an hole in the wall oval shaped broken into paper thin sheetrock it’s depth as black as dancers pants as black as Obsidian and night terror of obsidian waterfallen black as his mothers stubble hairs were so long as to no longer even be called stubble and to be called as a stallions mane between her legs spider web tangled and that he is told he must go into that depth that the blackness was him and he was it how he did not like this one bit protested the whole notion but was pushed in anyways and trying to return to the room where his human mother was he had hardly known her yet had yet even to drink her milk doctors saying no and turning him back again saying There there go on now go forward brave young Jaguar go on be a brave little pilgrim yes and so having no choice he crawled along then into blackness how awful it was how it was just that how miserable in the trenches of nothingness but well it couldn’t be total nothingness then could it though for a long time it seemed it was he didn’t know any better but realized well there was him at least this baby Jaguar with no pants I’ve at least got me I am here after all beholder of nothing oh swell he thought not much of a consolation but well their must be at least this one other thing too he thought there must be at least a ground right a foundation if not them what am I crawling on right but wasn’t so sure about even that and so as to test decided to teach himself to stand and standing up just as a little baby is standing up for the first not so easy at but the desire easily outweighing the obstacles not even a question really and not long after that well he was walking walking like a champ already an early version of that trademark Jaguar strut muy casual developing and not long after starting to wander and to wonder from that point forward almost constantly wondering and constantly remembering remembering and wondering wondering exactly how far away he had walked from his mother and all those doctors wondering why he didn’t miss her more and who she was and thinking it helpful to decided of keeping track of it all to know where he was in the drywall labyrinth of forced into this was the challenge that he started marking points in the darkness sending his visions out in waves pulsing in this void so pure and obsidian black you know just a few minor superficialities just to keep track of no big deal but that they started to get how do you say complicated and therefore compelling that they started to take forms emerging from him like emerging from Itzamna’s headband the beaded flower from which oozes sap wax honey dew sweat and birth control pills till realizing this as a mode of not really eliminating the darkness traveled through but trading instead inside for out and in making of a cradle for the Obsidian vacuum of his heart like a Venus transit blacked in slow crawled across sunscape marked points within himself were treated as though authentic coordinates of navigation that a map of this territory could actually exist was a silent love he found himself lost in and that no longer would he know again for sure which came first he loved just as much these points that were his K’ul the markings on his plain scroll made like a maze of dotted by flowers shells obsidian jade and mirror made like maze of maize he was silent and lost in till finally a voice finding him a woman’s voice and Jaguar thinking it to be maybe one of the nurses calling out to him or even his mother having recuperated from the stresses of labor gone to look for him but that it was none of these that the voice then whispering to him and that he couldn’t see it and looking around frantically the voice saying Don’t bother trying to find me I don’t want to be found but don’t worry soon I will come and find you when it’s right I will come for you a voice soothing sweet accented smoky and sounding deepened by a voice being a voice that seemed pink as a peach and with the same fuzz on realizing then he still had never even used his own yet so how did he know this wasn’t it and that Jaguar Pants shouted in the tunnel then to feel in his virgin cords new thunder demanding of Who are you and that she ignored his question and spoke instead of the things around him things of his to have supposedly made like long vistas and seas and seas disappeared like lifted as misted to cloud forest centered of housing calendar wheels and wills like wi’l of Ka of the Manakin sceptering tended to of gears maintained Kawi’l control flowed by like time is to man as kin is to manakin is as kins and tuns of time to Flare’s breath breathed of guardian arched of Kawi’l’s L Kawi’L to breathing of we all need an angel and that the voice said I am not here to talk about myself but to explain of the signs of day the day in and day out the damaged goods you see surrounded here of Manik Lamat Muluk Ok Chuwen Eb Ben Ix Men Kib Kaban Etznab Kawak Ajaw Kan Chikchan Kimi Akbal Ik Imix and that they are adorned as the etched forever into the gears of such calendar wheels as to have preceded always having been of eternal precedent of turn that once meaning to be as living beings were these signs of day to be thought of like as people are and walked to of towards and known that they did once live and live as all of each with their own personality free of will and qualities specific histories and stories of their own made like ideas and dreams culled single shaped of maybe even ego? some more than others that they lived long lives too until the priests of the long count came of the holy diviners arrived like such men as aspiring to take from them power drunk of ideas such as sign of days as mathematical symbol day sign as lotto number or else chip of rouletted wheel of chance as token of tun & kin to play in attempt of control like domestic animal dogs are or kitty kat horse or for token coin of to be made as Maize made determinations could be or else by knowing such signs and their rapport with the solar and calendar with the vague year too of it’s hazy Venused rolls to interact with all that one could prophesize and gain and not to mention an unhealthy preoccupation with the end of the world and the eradication of the human species so exciting it all seemed enough to go on with it at least till of course realizing finally they fooled themselves with this dream-lie of advantage and in doing so had been turning these signs into manakins well they were only men after all men trying too hard of to look at life through such crosshairs of galactic alignment who could blame and with every word out their mouth spelled now with a capital cosmic C they will be forever in debt making payments through passion the kind that usually only wing-nuts and the homeless are sacrificed to the forgotten living behind donut stores and in dumpsters walking in circles in parking lots almost always being almost hit by a car standing around asking for free coffee for change or scratchers packing the bowls of pieces concealed in trench coats worn on the hottest summer days crawling through shattered glass with their backs all sunburnt or some of the former that they do have homes and with their curly ratted hair and unsettling eyes the creepy smiles on their faces peering out from the authors photo on the jackets of their self published specialty books the bizarre bullshit no one wants to read or else the homepage of their websites that these are the ancestors of the calendar men their rightful heirs and inheritors of Kawil’s debt to be dreamed or smoked away but never escaped that not knowing but sensing they searched and in desperation found what the words they thought they were looking for of Blood Scroll Temple and driving such men to seek salvation in the written in of Blood Scroll obsessed of that their answers are all written in Scrolled of Blood and hid in Blood among written by Scrolls of Temples and the indebted being forbidden to know of how the Blood Scrolls are written and not knowing of how the Blood Scrolls are to be read but of the fact that Jaguars all born known how like reading of Blood Scrolls and of Blood Scrolls of smoke Blood Scrolls of ocean both salted and disappeared and disappeared Blood Scrolls and Blood Scrolls of empty minded as Manakin day signed not to forget and reading of Period Blood Scrolls like Jailbait writ to sheeted of fabric or fur Blood Scrolls written of Blood drunk by the sounds of the woman’s voice assuring Let me explain that it’s simple of if you know how the different Blood Scroll Temples are made that you will begin to know of how the Blood Scrolls are written and if you know how the Blood Scrolls are written then you’ll begin to know of how the Blood Scrolls are read and starting with the Blood Scroll Temple of cement made like first purchase limestone sand and gravel from a cement manufacturer and if you have money to burn have a kiln assembled from a manufacturer if not you can skip this step gather the limestone sand and gravel then place them inside the kiln if you don’t have a kiln bring the raw materials to a pottery manufacturer and have the raw materials heated heat the rocks at 1000 degrees Celsius or above for about 12 hours after heating the materials should appear partially molten add water to remove lumps from the substance add some sand to create a paste-like material add the gravel to the mixture stir the mixture thoroughly until it thickens make the walls and ground of the Temple with this make sure to lay your foundation down first keep add water every so often you want it fairly malleable soft like winters monkey bread cooking you’re also going to need trowels shovels and wheelbarrows and Blood Scroll Temple of Winters Monkey Bread made like Ingredients: 4 cans refrigerated biscuits 1 cup packed brown sugar 1 1/2 sticks butter (3/4 cup) 1/2 cup white sugar 2 Tablespoons cinnamon 1/2 cup raisins (these are optional, it's great with or without them) Directions:1. Preheat oven to 350 degrees F and grease a 9-10 inch tube pan. 2. Mix white sugar and cinnamon in a medium sized plastic bag Cut the biscuits into halves or quarters and place six to eight biscuit pieces in the sugar cinnamon mix Shake well 3. Arrange pieces in the bottom of the greased pan Continue layering until all the biscuit pieces are coated and in the pan If you are using raisins place them among the biscuit pieces as you are layering 4. In a small saucepan melt the butter with the brown sugar over medium heat. Boil for 1 minute. Pour over the layered biscuits. 5. Bake for 35 minutes. Let bread cool in pan for 10 minutes, then turn out onto a plate. Pull apart and add Icing Icing Recipe Ingredients: 1/2 pound cream cheese 1/2 pound butter 1 pound powdered sugar 1 teaspoon vanilla extract 1 teaspoon lemon juice Directions: 1.Allow cream cheese and butter to get to room temperature. 2. Beat butter and cream cheese together in a large bowl with a mixer. 3. Slowly add in the pound of powdered sugar. 4. After all the powdered sugar is added mix for 12 minutes (do not mix less than that). 5. When almost done, add in the extract and lemon juice and repeat thousands of times make several thousand batches build your walls with this use trowels and wheel barrow work the monkey bread like cement add water whenever necessary and the Blood Scroll Temple ruined made like Blood Scroll Temple of cement then abandoned till found in ruins like abandoning beautiful for all to be in ruins as of in middle of empty field tall still stood cemented squared of foundations crumbling with half of two walls missing barely a roof cracked and crusted cement blocks graffitied hot pink and black rebar broke glass and candles lit round and inside where Jailbait lounges three of a kind slouched over lazy hair hanging vomiting lilac pooled of ring pops on fingers not licked since last nights sick when going to Club Lamat of weekly rave designed to lure tourists mostly with idiots of all sort taking place in a secluded warehouse miles outside the outskirts of Antigua decorated with papier mache Stellae glyphs inaccurate rendered in puffy paint a mural attempting to depict the seasons passing through nearby mountains a long skyband also prominent featuring glyphs for sun moon and Venus and across the room another mural long line of painted Jaguars marching leading the eye to DJ booths surrounded of faux fauna phoney Ceiba and party store palm store bought and of all the bad E they’d taken only feeling the speed it was cut with the irritability and draining of life force in forced dripping raindew lives essenced harsh come down with so many holes in the brain till as jellied Calabi-Yan is totally Etarded with fluids leaking out the cortex like windex through paper towels and sliding down spinal columns the grinded teeth chipping as Hands Shot to bone shards and shit and aching jaws made like safrole: 3,4-methylenedioxyallylbenzene, 1-(3,4-methylenedioxyphenyl)-2-propene isosafrole: 3,4-methylenedioxypropenylbenzene, 1-(3,4-methylenedioxyphenyl)-1-propene MDP-2-P: 3,4-methylenedioxyphenyl-2-propanone, 3,4-methylenedioxyphenylacetone, 3,4-methylenedioxybenzyl methyl ketone, piperonylacetone piperonal: 3,4-methylenedioxybenzaldehyde, heliotropin beta-nitroisosafrole: 3,4-methylenedioxyphenyl-2-nitropropene or more synthetic routes that can be taken once the MDP-2-P from isosafrole is evaporated 1.Sodium Cyanoborohydride 2.Aluminum Amalgam 3.Sodium Borohydride 4.Raney Nickel Catalysis 5.Leukart Reaction via N-formyl-MDA 6.Leukart Reaction via N-methyl-N-formyl-MDA and who sold it to them anyways was a guy they were referred to as a mutual friends ex he met them in the alley a furry Jaguar hat with the long ears flaps tied together blue face paint whiskers and I like your hat what’s your name them saying to him and Oh thank you replies I have no name none of to speak in such a world though I am what you might call the Jaguar God of terrestrial fire and I am here to help you girls get ignited and laughing cause he’s cheesy but kind of charming So what’ll it be Oh we’re just trying to get some Molly they say and Yes yes of course unzipping his backpack and that it was shaped like a Jaguar plush of an animal with arms as arm straps hold and zipping down its belly produced several zip lock baggies the first he says is Orange sunshine and it’s the best stuff I have right now it’s what I’m currently rolling on and totally euphoric and holding up another bag says This one here’s some stuff called kaleidoscope I haven’t tried it yet but the guy who sold it to me did the other night and said it was phenomenal really good very pure and Ok let’s see what else here and digging through the plush belly says Well I don’t know if you’re interested cause this definitely isn’t E but have you have ever had Special K before it’s basically cut with horse tranquilizer I would have to recommend trying it if not now then someday soon it’s fuckin awesome man just chop one line and off you go you’ll be lifting cars off the ground and shit and saying Um ok what else do I have hmmmm I’ve got some white elephant here some molly apple yellow kool aid some lavender swan and I think that’s it oh wait I’ve got some purple alien also but I’m kinda saving that for me well there you have it so what should I put you ladies down for and that they kind of barter about the orange sunshine pills for a while but really he’s pushing for them to take the special K none of them want to do it though none of them have done Ketamine before and don’t want to start tonight saying oh no we just want to dance and have a good time no that sounds too intense etc. till finally he makes a deal with them says I’ll give you each two doses of orange sunshine for free but you also have to take some of this K with you and promise me that you’re gonna do it before next solstice and also when you do fuckin call me up first cause you girls seem really not to mention beautiful as hell I’m always looking for pretty girls to roll with you know and then he tells them a story about a rave he had been to in Europe the previous summer called Czechtek and how there was a federal raid police showing up in riot gear shields lead vests and tear gas to shut the party down and that when he saw them he said he was candy flippin and thought they were just part of his hallucination I thought it was harmless he said I thought I was just watching a cartoon or some shit you know until that motherfucker took a shot at me in the side of the temple with his lead stick of black licorice baton un-tender and un-lithe and dragged me two hundred yards kicking and crying to a police van and telling of here he was handcuffed and thrown in through the back with twelve others tripping sweating and dehydrated ravers begging of We’re dying back here moaned in unison and with the guards opening bottles of Gatorade and shaking them out onto the captives captivated of red liquid splattering cross their clenched faces paled mouths open eyes tight shut looked of perfect desperation they were physically and metaphorically rolling round the sports drink lapping it up off the dirty floor of the vans carpeted to absorb the electrolytes through their skin rubbing faces into the sticky puddles was hard to say who was enjoying this more them or the riot cops and that they threw the empty plastic bottles at their prisoners stood up and kicked in the head the ones who were kneeling down kicked the pacifiers right out of their mouths and this story going on and on the conditions in the cell how his friends had to come and make bail and that to raise funds for this they threw a weekend rave in their flat of how six attendees ended up hospitalized and the Jailbait girls having taken their pills at the beginning of this story were already starting to feel the effects everything all elve tingled fractal massaging of arms legs and spine and for the whole night from then on to be a blur that they had somehow ended up here in such ruins of Blood Scrolled ghosts meaning they must have spent the night and now weary and depressed with sore jaws and searching surroundings of corners and floor and close to the floor gagging of heliotrope corn syruped jazzberry pukings is another across that they recognize of one of the gang the little sacrificial lamb of little Lemon Jailbait she’s called and with a little Lemon dress is youngest and littlest of all them and that she is tied to Ceiba stakes then planted with white frosting colored lace skin tanned gentle graham cracker of freckled brown sugar and orange glows glimmering of auburn hair pigtailed and how it was all her idea that she asked to be tied up this way and her guardian saying Are you sure double checking guardian standing with her there as well Mr. Lemon the pedophile cupid like cupid himself a babe but to be pedo or Habo of Habeophilic of his bows and stock at the ready since such a day as the day he was born a lemon headed man oversized and ripe lemonhead anthropomorphic with vague trace of green ended on either and having spent his whole life in imitation like all of such mischievous angels of young love patron saints Puck and regular original cupid of his heroes Valentino and kissing him by a crystal blue Italian stream that he’s tried following in their tracks walking the mountains shooting his arrows this way and that just following instinct and heart but see he’s got a bad track record bad aim and a bad habit of using his arrows on the much too young hence the nickname it’s true he has an eye for the underage almost exclusive of a predilection for Jailbait aiming for young farmers daughters milkmaids and schoolgirls its how he wound up with this one Miss little Lemon JB he saw her first at the library checking out books Nabby Sylvia P. some poetry Dickinson Un Saison En Enfer Illuminations some young adult fiction and a stack of magazines though he didn’t shoot her right clearly she didn’t need it she was already in love with everything he could see it straight away in her eyes and smile she even smiled in her sleep and though he never dared aim his arrow he did talk to her admitted even that the thought crossed his mind explaining the power his quiver held and what could be that any love could be hers (or his) if only he was so inclined all to which she giggled and invited him over to her house while her parents were out of town and that here she read him poems from her newly acquired books and that they drank iced tea together and finally as the sunset demanded to be tied up of which he obliged her though rather surprised at first shocked really he tied and fastened her to a wall in the living room hands over head and walked away for almost an hour leaving her stranded tight taut to gaze around the room framed photos all over the wall pictures from her childhood all with parents on vacation in Hawaii onboard a cruise ship her portrait from tennis camp already traces of her dirty Lemon grin in all only a baby then and still and that when he returned he had with him a plate of sweet Winters Monkey Bread hot made fresh out the oven of a batch baked into shaped of miniature log cabin just like the kind they bunked in at sleep away tennis and thinking Oh so that’s where he’d gone to plucking odd pieces off of to push right into her little Lemon mouth all polished with Lemon lip gloss and licking the sticky icing tips of his fingers she asked for another piece and he said Certainly would be happy to oblige but doesn’t let her lick his fingers this time instead using the extra icing to write his name on her stomach lifting up her dress it tickles writ in all caps he goes MR but doesn’t have enough so its back to the plate with all the good icing around the perimeter is the secret having slid off already so he rounds up a good glop on his index and goes back to finish of LEMON and she giggles till leaving her dress lifted pulls away panties powder white and pushing pressing into as pushing a button is for such a stream of citrus Squirt Lemon Squirted as honey cleared cold gushing rapids of Squirt Scrolled flooded floor leaks all panting and crying out like breathing heavy says It’s time can we do it now can we please? please please please and at first he doesn’t know what such an it is she’s referring to be but then with pleading eyes and a nod of the head towards the quiver pouch slouched in the corner it dawns on him and yes he does shoot her close range right in the chest plate straight between the Lemon buds of her chest managing not to hit anything vital but for a full five minutes her eyes are rolled back moaning and rolling her head around in the agony and the ecstasy and Mr Lemon feeling sick at this sight though it has worked in a way that she’s fallen in love though not with him with an idea of a fantasy of a childhood dream flashes in front of those horrid minutes hanging from the living room wall of her parents home with an arrow sticking pointing straight horizontal out of her chest as a scepter as a sundial to make Kawi’l’ed shadow from a sunshone stand stood mars black in shadow of an invisible manakin such as such and this dream growing fast into a plan is a secret held between the two of them exists as link and bridge and wall and barrier as anchor and blackhole as fate till growing unbearably fond of her in this way listening to her talk about it everyday of wanting to ever since she was a little girl but never realized till now and remembering at the circus being bought one and letting it go it was blue one too and watching it smaller and smaller till it disappeared blue disappearing into blue asking her mother Where’d it go to and telling her the truth of it could only get so high before it has to come back down has to drop that word sticking to her then of dropping and wishing from that day forward only to drop the sound of her voice almost as if it had been his heart penetrated that night and telling of the dreaming that she wants to be tied again but this time to a group of balloons of common helium type colored primary flat enough to lift her from the ground like hydrogen and helium atoms are lighter than nitrogen having fewer electrons protons and neutrons than and making them lighter like the approximate atomic weight of hydrogen is 1 helium is 4 and nitrogen is 14 and like a 100-foot-diameter balloon can lift 33,000 pounds and to figure as of determine the volume of the balloon by the volume of a sphere is 4/3 * pi * r³ where r is the radius of the balloon so first determine the radius of the sphere (the radius is half the diameter) cube the radius (multiply it by itself twice: r*r*r) multiply by 4/3 and then multiply by Pi and if you are measuring your balloon in feet that should give you the volume of the balloon in cubic feet one cubic foot of helium will lift about 28.2 grams so multiply the volume of the balloon by 28.2 divide by 448 -- the number of grams in a pound -- to determine the number of pounds it can lift so for example a 20-foot balloon has a radius of 10 feet. 10* 10 * 10 * 3.14 * 4/3 = 4,186 cubic feet of volume. 4,186 cubic feet * 28.2 grams/cubic feet = 118,064 grams. 118,064 grams / 448 grams per pound = 263 pounds of lifting force hands over head fishing lined bound of the wrists but not ankle to have legs slack as Manakins for arrival and to be made free of gravity to sail maybe to Paris is where she’s hoping every girls dream of gumdrops boys and Paris in the spring or maybe that they’ll pop and she’ll fall into the ocean to drown or be eaten alive no matter what the outcome it’s what she wants a fate chosen for herself to let fate choose and it’s the not knowing that excites her gives her butterflies in the stomach keeps her Squirting at night but he is afraid for her and not just for his own reasons has plenty reason to believe it wont work they’ve done tests for example made an effigy a Little Lemon jailbait made of monkey bread Manakin her exact measurements her exact size but not the same weight with Monkey Bread weighing more than she does and that they tried it at sunrise on a clear day and with Venus as morning starred good luck light in the sky balloons on fishing line tied round accordingly primary colors and white they kept adding till starting to lift then with Mr Lemon holding it down she added a few more and gave it a goodbye a kiss her Monkey Bread double lips she even cut a tiny square off of her dress and sticking yellow fabric to it they let go and watched her lift for a while weightless even with it working beautiful for this glistened silhouette all sugar stick brown born drifting across of sky band and such a calm day of tranquil wind and not but a cloud until upon reaching a certain height she couldn’t and sort of starts to drag for as they chase for a while after her by car for miles till ending up stuck tangled in branched tall like limb of Mahogany Caboa upon such where as a napping Jaguar was stirred and woke found delighted a wonderful morning treat shiny and sticky they watch open slack awed of Jaguar devoured dessert double with forearmed paws crossed over front he takes off half her face in one bite chews it while looking off into the distance majestic beast is stoic and almost bored of expressed spotted face sweet winters monkey syrup dripping down from chin like blood and thinning his saliva such as to making him thirsty and descending for water of Mr. L and Jailbaby baited L retreating didn’t speak of the incident for months till thinking the whole thing finally over and feeling good about it so secretly in delight and relieved thanking the heavens for by now he couldn’t imagine life without her life without Miss Lemon Jail someday we’ll die together he thinks perhaps in a shipwreck or Hands Shot to pieces till bleeding Scrolled to it or else fallen together over the edge of a great waterfall would be good to be buried together too or else placed in identical Ceiba caskets and carried by mourners to the center of town and walked around the fountain circling for three days or more with no rest like the Tattered Jaguar Wheels turning is how it’d be and just think how strong and revitalized those Jaguars who go in come out the thousand dark nights of the Jaguar soul to be made tattered by the limbs of dead trees and made new like the seed of the squirt is taken to invisible by the flame of the pyre and that even in death they would be connected with a string around his finger slipping out his lid leading to hers but as days go by it gets worse the arguments and rows always it’s No you will not sail today reminding her it’s not safe yet there’s more tests need to be run and throwing tantrums she says I want to go to Paris now I want to be in the sky and dropped and DROP ME DROP ME wanting to be collapsed crashed on the cobbled streets of gay PairE she’s demanding it now and the bittersweet of his lips knowing that while he may prevent it for now he can’t forever that someday she’ll leave and of course eventually she does for a while he’s distraught but managing he stumbles through his own life like a fever dream has laid down for good his bow and arrow till one night he’s particularly bad off hasn’t talked to anyone for weeks and is in the bathroom sitting there cutting cane sugar into lines on the edge of the sink with a serrated kitchen knife and snorting them getting dusted he looks into the mirror squinting at himself hating what he sees his big ugly yellow face and looking so old now too all the lime spots on his rind faded thinking she must have taken them with her and using the knife cuts into his own face carving into rind and extracting huge chunks of lemon falling in great splashes out into the sink already half full with water and falling over screaming in agony but knowing the end is near knocking the sugar pourer onto it’s side is spilling it’s contents to the sink as well his last thoughts are of her wishing her here not to see him as he is now his face a hollow cavern all yellow lit fruity viscera but to be here and drink of the lemonade he’s left behind him and oh to see her one last time to touch of skinny limb and tiny hand and to explain the Wheels to her seen as he dies his hope only that his soul now might float away and find her and to sink into some dark and quiet place inside Little Lemon Oh to sleep there forever that it might be a place no one else has ever known he smiles of that it is as the begun of the Blood Scrolls is writ as per accordance with entry to temple is and to explain the Blood Scroll Temple of candied jawbreaker made like Jawbreakers are made by the hot pan process and the type of pan used very important candy-making pans are little like pans found in an ordinary kitchen that they are huge spherical copper kettles with wide mouths the pans rotating constantly over a gas flame for the sugar inside kept tumbling and that the worker who makes candy in using these pans is known as a panner a worker putting granulated sugar into the pan while the pan heats over its gas flame each grain of sugar in the pan eventually to become a jawbreaker as it crystallizes the other grains crystallizing around it in a spherical pattern that the panner begins this process by filling a beaker with hot liquid sugar and using a ladle carefully pours the liquid sugar into the pan along its edges with the liquid sugar adhering to the sugar grains the jawbreakers begin to grow and that this is a lengthy process with the pans continually rotating and the panner adding liquid sugar at intervals over a period of 14-19 days and in total the panner may add liquid sugar more than 100 times for a batch and with the Blood Scroll Temple of candied jawbreaker requiring more than 60,000 batches for each wall can you imagine that the voice asking him now This process repeated over and over 60,000 times the dedicated Jailbait workers toiling away round the clock and calendar and that upon this last word of calendar Jaguar Pants grows dizzy seeing sudden in front of him the great wheeled gears of the calendar interlocking days of solar and days of Tzolkin hung suspended in front his eyes glowing now in dark of labyrinth hollowed hospital drywall he had once walked into and still with rope tethered back to he cuts it now in order to approach closer this calendar the voice speaking to him of encouragement enticing to touch the gears and to know of them like Blood and Scroll soaked and scrolling down blood to become word saying that I am also here to explain to you the signs of day written like first sign of Imix the first and the father Imix 1 speculative and who looks as three planets spooning on celestial mattress spooned looking left to right punctuated by an horizontal crescent under orbit made of circle for support that what this is under there is perhaps a necklace maybe pearls sugar treated Opal or other and shaped like rain dropped here or else a basket or basin a curve of promise to hold sturdy them they of this first and exact and wondering is of which planets involved like Venus planet of love with it’s Jaguar glow white like wild white orchid of the sky umbilicus reflected on our moon too or sun then also it’s stamen though would sun ever get into bed with moon and for a three way at that well and with one of them bleeding of shed linings and walls gushed rasped stuck then what do you call the transit then? perhaps not the same but lets leave that to the side for a moment like maybe it’s Mars we’re seeing here Mars would seem an obvious match for Venus sphere of war sphere of romance opposites do you know yada yada ya ya stuff of opera high drama possibility but no it’s not what we’re seeing is just one planet is in truth only Venusian seen specific phases of and that she is in transit we were sort of right and her white surface bleached by sun’s light and aglow been actual gaseous and mist makes it as perfect precedent for the Jaguar Pants and how they glow that they walk is the same as how her mist glows and becoming black to us in passing oh say every eight years is like baby becomes daddy once a life and that this aspect of Imix looks also like a human fingernail the Lunula the nail plate and the ( ) of the calcium grown that you clip and toss it to maybe the calendar men must have noticed this in drawing this way that they had taken in the little ones that spring forth till high and staring at their hands noticed it hey we’ve all been there right and that Imix is all these things but no T that his sign could be seen as triangle love or of any combo of of well that says something about him right there his character and essence if you will these things stripped down and simple principles here that two year olds could draw them and him having never even heard of Venus and written like the second sign of Ik looking like a T hovering in a mirror this being an unfinished cross or crux? not certain but it looks to be of wood of bamboo maybe of pine or Ceiba and that the calendar priests could not come up with much else about Ik could no T being so early in the Count offering little else to compare to and concluding her to have some sort of unspecified association with the Jaguar world of Seated Tattered and Wheeled or else Colossus the population at large but why assume what clue in glyph writ not a claw or else no spot but that with simple shading could only be one or other of in or out of T of ou T blacked in or in blacked ou T as like melanistic as black as obs often called panther or rare albino glowed as Jaguar Pants glows white as hissing slow like Jaguar Pants glowering as glowed worms warming white as white lies told of wild Jaguar cub sauntered from forested centered on days of when Ik seated and that with all spread out in the calendar courts they would always walk towards her glyph first and sniffing away the sniffing seemed to be not of the going to make a meal of variety but more the devouring with passion kind the sniffing of lovers hair for instance all coconutted Pantene Pro- V concluded Ik but to be a sign dealt with and of of vanity or else just self aware shaped flat and with all these signs having the same round cornered framing it is still suspiciously appropriate in Ik for her frame to seem more a mirror than the others could be telling to her character of Ik as much as the confusion of the planets speaks of Imix and the T floated of the disappeared no T could it be of third phase invisible of vague Venus Vague yearly gone and written like sign of Akbal who looks like and is as such the sacred honey bee thought though do not swat at him as to get away and do not seek refuge in water or else run listen to his songs let him sting you and kiss once his only and pay close attention to his flight the patterns of figured 8 flowing against the bleached white iris diluted and damaged pupil of bleach toss sky of the north bound God K charmed wanderer do not bee scared bee happy like the honeycombed wax comb sea foam green is pulling the Angel L’s hair yellow on shore is with the sight of sting on her thigh the little island of tiny sweltering volcano like pink lemon is mounded sore above such pale skin milked and willowed to blow cold air upon this cone cold of breath of yours and the sea’s that she needs both is what Akbal may bee for you today at home removing the stinger with your fingernails like Imix sign and applying ice to the wound rubbing alcohol and a slice of lemon I hear toothpaste works too she says taking two ibuprofen leaning her head against you calm and smiled soft of elfin features perhaps but another day beeing different maybe he’ll bee the night house like they did say he associated with fraternized and talked into bad influence stung in your mouth Akbal to write in your cheek with sting written like the sign of Kan who is as a ditch dug into earth a basin is to catch the rainfall maybe for in those days was how drinking was done to store it for dry day and season for our thirsty children un saison en secheresse drought doubted is death but it’s pretty typical of Kan being such a very generous sign volunteered to be the landscape upon which all signs coming after would exist and a majestic one at that such as completely mothered and fathered at once and twice in blue whaled sky blue of blue as lactarius indigo gone above with Venus in daylight phasing bare and unashamed in splendor again and again like Jaguar Wheels turned yet with a darker border around Kan’s outlined black as obsidian like black Jade forced sun kissing blades handle handing obsidian watermelon seeding out to coal powdered Venuses tiny of one two three like phases of Jailbait the birth the blossoming of into bait and the receding seated when jailed and missed un-yearned for mist Jailbait feeling misterios steps from such seat to Squirt on the floor or one two three like the turn of an L these phases reflected in the rippling basin watered again that we find in these signs a mirror here in fact two of one of nature and one for ourselves one dug into black the forehead of Kawil and one that exists somewhere beyond him hid in the ribbon ripped smoke and that the calendar men often took on apprentices to assign each of a day to research and report back on writing on them sometimes of it’s glyph in blood but never in blood scroll sometimes in ink of writ in stomach or neck and those assigned Kan discovering all they had dreamed the same like one was the dream of a Kitten come down from the dead mountains with a mouse in its mouth soft and precious like it’s fur blinding as white lighted Kan cross worked over codex coded in the bark of the branches the six sky world tree in it’s mid and just as curious as it was scared muy curioso drinking from Kan’s basin attracted by the sweet smell of milk as happened to be leaking of it’s sap that the Kitten Kat Pussy-kins or else puss-tuns sneezed uncontrollable with all the wet milk upon his nose till appearing up from behind came a silent Jaguar strutting till casting the sneezing kitten in it’s shadow of strut looked down on this tiny cousin of in contemplation that the Kitten at the right moment always looked up to greet the dreamer awoke seeing now the Kitty’s affliction having only one eye it’s socket moist and pink as berry that it must have happened recently a tiny tear of blood run down fluffy cheek and each awake reporting found the sight too sad they forced themselves to and to lie wondering in morning stars half light of whether they had gotten it wrong that those circles in glyph of Imix and in the glyph of Kan maybe never were Venus at all perhaps instead intended as the human eye is being that which perceives her the eastern and western conjunctiva sandwiching the pupil with it’s pit matching and mirroring her that perhaps in Kan the black border was made not of sun but from the hazy edge of a nightmare’s final linger as lids parting and again this creation is beheld and written like Chikchan who looks like the Angel L in a fog her red coke can glasses aglow only visible as she is walked towards Chikchan an underrated day sign that it is bold enough to be blank with exception of only this one thing such aching devotion that it saying almost damn the whole creation let it all be stripped away except for this love these red plastic specs to be nothing without this subject without these glowing cherry red and approaching saying we all have empty days inside of us but watching us glow hid in stasis fogging like days seeping from white noise as counterpoint to Kan’s bordered black like glow from back light and written like the sign of Kimi the pervert lecherous of sign of Kimi called as death as often as mother and Kimi who looks like a fluttering that maybe we could call her a rapist she acknowledges readily urging us in analogy to remember that the child is like ourselves but seeing we are dying and that she sits alone and still for so long in her room a whole summer alone and quiet stong summer sun in beamed through windows to close her eyes and see the death of white Venus aglow always it’s an imagined death always a shining white daytime death for her soft scarlet lipped to mouth some unspeakable words that she for some reason carries inside her as empty husk of day seeds like the rapeseeds of the opportunist Kawi’l worded like Jailbait forced to squirt and Jailbait bound and squirting Teens first time on camera and Shy Teen Squirts and Shy Teen outdoors and First time Squirting outdoors and Teen Squirting parallax of Shy Jailbait Squirt Squirting in unison and Jailbait Parallax of Squirting Outdoor transit of Squirt of Tied up Teens parallel Squirting in transit of Jailbait Squirting party on trampoline to squirt to the center of to trade taut for moist-slacked trip for laugh and that she does and sings to herself beautiful songs of death and shame for the blood shed in excuse of ancestors of sun bleached corpse or fossil for naught and claimed to her the passing seasons as joy to sing of them so till gagging herself with a black trash bag when she talks and holding up to the light the petals of dead Rivea Corymbosa while and oh Kimi to clench between fingerstipped twixt thumb and index that this is of Manik’s sign that it is as Manik looks of Kimi’s hand a prophecy of him and this making fingers of the two lovers to be wed in a way as this with the petals they once held to their lonesome’s hold now dropped and spread all about their honeymoon suite and across of bridal bed and that Kimi is a dancer and dances in them falling over herself laughing and dances out of her dress for him and that the orbs in Maniks fingers are written upon her skin like her dance around with the dividing petals in her signing the question of her sign the question of everyone’s wonder and has been all her life of which side she is on of what moral ground will she die upon if any question of seed of life or else like like ( ) and that later with a strip of trash bag again tied round her head clenched tween teeth and fully naked Kimi begs of him some inaudible and Manik sitting across the room on the edge of the bed eating from a bowl of K’ul berries smiles at his bride her legs open and gazing into ( ) he sees the multi fold written like Lamat sign of moistened flesh the siren diamond like a human Janus door that it glistens and calls him and that when he passes through that she knows herself finally and only then and what her sign is that her sign with it’s two rings is two sides of the same thing as well as passage way as well as ovaries and the fluttering wisp between them being her too that she is forever this way being all three but mostly the wisp always caught between is her perfectly as dancing this way the black bag that gags her is this is a single glory petal between her tips and with Manik inside he takes new meaning as well to shoot wild seed the circles of her sign she thinks destined to be pinched together by his by sureness of two fingers met like pantomime of the instant of and like fingernails clicking like dual Venus’s collided in space or else Venus rushing into her own reflection the recognition of the lunge and the injury that he holds her in them so tight till the sign of Lamat comes written perfectly like the moment of two fingers abandoned for the whole hand like inside her is a pomegranate squeezed in his palm juiced and pained dripping running liquid between knuckles fearlessly fisting her and eventually Lamat again seen as the sign of birth the dilation making passage for the first child and that Lamat is the first thing the baby sees and they of it that they can behold at the same time Lamat as the frame through to witness one another and Lamat having always been there that Lamat was the shape of the stars spread above the landscape on which he was conceived a vista made like of every sign to come before them is clear and that the baby is named Muluk and is a sign written and looking as most do a little like his mother and a little like his father with his glyph split in two the maternal left containing about half his mothers shapes and his own central divide bearing more straightness than his mothers more akin to the rounded corners of his father’s features that he takes also from him a token of his centered nature of bottom and lower center the nails of the fingers and the shell of his seed and that it is rotated clockwise exactly a hundred and eighty degrees duality in the form of what could be called collage all of fathers upper regions and it was predicted once that Muluk would be a hunter because of this because this aspect of his sign so similar to the passing of a sun dials shadowed in and how all true hunters could make and read these with ease and that indeed he did hunt by the dial starting off from a young age stalking howlers gray foxes and peccaries both collared and white lipped moving on eventually to the tracking and trapping of baby Jaguar skinning them and spreading their pelts out at home for his parents to show off and impress and then as a family they would look for patterns in the markings Manik boasting his skills of divination he would read their fortunes by the fur You my boy he would say to his son You are very lucky Oh how I envy you for I read here that your sign is associated with none other than the Water-lily Jaguar Muluk then very loudly protesting this Ah Dad no! The Water-lily Jaguar’s for sissies come on Water-lilies are a girls thing Manik laughing at his son teaching and telling of That’s simply not true son the Water-lily Jaguar is a protector and having this protector on your side will make you a better equipped hunter than you already are please try to understand that the Water-lily Jaguar will hunt those who hunt you those who stalk in shadow how the Jaguar of the lilies specializes in this in the in between parts of things and besides you didn’t even let me finish for the Water-lily Jaguar is not the only one you have in your corner my son there is also the Tonsured Maize God who as you must know is associated with night and from what I hear those born with night associations within reach of their sign end up doing quite well with the ladies if you follow me and that Manik jokingly put his hand up so as to block the movements of his mouth from his wife’s gaze at this last bit and even offering a wink that he spoke in whispers when pronouncing the ladies part and Muluk giggling but still stubborn with protest that he even went as far as to say Yes I see right here the pelt’s markings are telling me you are to meet a girl soon within the next year in fact and that eventually you will take her as your wife oh how happy this will make your mother she’s always wanted a daughter oh I say we start planning the wedding at once now teasing both son and wife and with Muluk shouting in defiance to throw a tantrum till Manik having gotten his chuckles in attempting to change the subject says How much do you know about the Tonsured Maize God anyways and then taking the silence that follows this question to mean very little begins to espouse his greatness The Tonsured Maize God my dear Son is one of the most important of all Gods for he paddles the canoe from the underworld that brings us not only maize but Jade also and Cacao as well he is a patron saint of feasting and a world class dancer probably this must explains a lot about his popularity with the women folk I’m sure and now biting his tongue realizing he has brought up this topic yet again Kimi intervenes saving saying Why don’t you read mine now sweetheart and that he tried but couldn’t never could read his wife’s fortune nor draw her portrait was always incapable of these and it wasn’t that he had issue with expressing sentiment to her quite to the contrary he had been very vocal about his love as long as he’d known her and yet for some reason finding it impossible to hold in the role of subject his love for her perhaps clouding his facilities the feelings maybe too tangled of a knot to cross through thinking wishes of to really offer a prediction just for her or some other such trifle better yet a vision if could be one that she deserved to match that which she already was for but besides this his guesses were always pretty questionable read mostly for familial entertainment though there was one thing he got undeniably right and was said to have read from the pelt one such night that of Kimi was pregnant again with her second child and that it would be another boy she had known as well but had stayed silent on the matter could feel it growing in her tummy but having said nothing to him was surprised to hear and sure enough a whole month came and went all with no period blood obsidian period blood obsidian period blood obsidian period blood obsidian period blood obsidian period blood obsidian period blood obsidian period blood obsidian period blood obsidian and then the swelling of her belly total preggers the cramps and cravings the glow with such vibrant rose budded lips lighted and with flushed pink cheeks as yogurt is and is cold as with eyes soft as pinkberry cloudberry that Kimi became like the tranquil glow of morning light always and standing profile bathed in such light once of a ghostly sea foam veiling of silk slung hanging off shoulder over surreal figure proportioned to newly round absurdities of alien and bizarrely alluring with stubble now grown out thick as Jaguar fur to part at bleached ends and rudded roots for Lamat beckoned birth of their second child to be born late of born on morning of winter solstice and as predicted indeed a boy as they named him Ok and how handsome his sign looked written like looking as a Jaguar does or else Jaguar skull smiling sk’ul blessed breathed sku’lL of babes own of having only one eye to look with and for and what a style it was for him that it was eternally young and Technicolored full of shapes looking as empty day signs look like egg shaped or husked seed of Ok were all about bounded in inside that cycloptic eye traced in a drawn line traced as a rainbow on the picture plane of courtly gay sun winks just yonder over green hill’s crest to scan such horizon for deaths favorite day and favorite sign of Lamat signs that are the freckles in his iris all a-twinkle in his eye that he hunted too but not quite like his brother that Ok was ultimately more adept for sport that excelling in the ball court a precocious athlete he was always his mothers favorite and that as he grew she watched him with swelling pride at the shape and movements of his body almost lustful in her own way that even as a boy he had a way of fascinating the way he would climb and leap for instance while playing with his brother always their favorite game the Hero Twins game ever since they’d heard the story it was always the same game in the backyard everyday of summer and spring with both wanting to be Xbalanque they would argue and fight over it till Kimi would have come to the yard and play judge to pick one of them always making up little contests to decide sometimes a simple foot race sometimes something more elaborate tests of endurance carrying buckets of rainwater long distance and the like and in this way tricking them into doing chores occasionally they’d catch on and forfeit going back to their game shooting blow darts at bird demons Vucub-Caquix and his flock fighting with the Xibalbans and the horrors that lived in their underworld knives that moved of their own accord winged demons nights of endless darkness and pefect solitude till once passing such challenges the brothers would ascend to the level of Paddler Gods sitting together in an old bathtub in the garden rowing away with fence posts they would become the sun and moon shouting to mom Mom look we’re the sun and moon can you tell can’t you tell which is which mom and the sign of Chuwen who is written not as another child of Kimi and Manik but the place where both brothers eventually came to die death by push and murdered as like in a Kimi song sung of girlhood early Kimi Jailbaitted Kimi death signed K though committed by who I cannot both brothers in living full lives were never short on enemies and unfortunately Chuwen offering us little in the way of clues by the reading of his glyph ascertaining of who looks like two waterfalls equidistance emptied endless from cliffs edge and that the resemblance between this sign and Kan is no coincidence but of confirmation for a symmetry existing between generations a Lamat like twinkle of recognition at their ends and beginning’s beaming in that Chuwen’s sign makes as a landscape for dying as Kan’s did for fucking or else lovemaking and that it needn’t be pointed out here but it will again that this all harkens back as well to Kimi and everything her sign was all her death talk and her rings that we see now we can add more meanings to their listed that they might very well have been her sons too or else their lives and demise down there in the churning pools of Chuwen’s perpetual spilt waters among the silver fish delirious leapt out the chaos of churning surface and into the hungry mouths of day time Bats swooped down from emerald lit caverns hid behind the falls and where their heads crack on the slippery rocks and of the sign of Eb who is the moment of death for both and who is written like the profile of grinning Jaguar his ears adorned with rings like translucent motor oil stained opaque into metal and wooded bead like pirate chic dumb with face riddled of acne scarring and a nonplussed lean to his lips that they died not at the exact same moment of course but so close as to be impossible for all but Kawi’l to detect even the fruit bats scattering were not able to tell through the twin splashes of river water they made but that Ok died first hitting the surface almost perfectly on his back and the whiplash of his neck and the back of his head cracking open on the slippery rocks that blood and bits of skull flushed out like raspberry snowed mud and that in a perfect monolithic shape of mattress floated down a skull scrap a flat rectangular tableau face down and afloat and how unfortunate for there to be none around to see how bizarre for it to be shaped like this so perfect but getting caught downstream in the tangles of overhung branch and the dam made of stray leaves black and wet that with the mattress remained for several weeks crowded with mouse and shrew alike envying from the shore thinking How nice and If only we could drag it ashore the bed we could make of it and one mouse remarking Oh the wonders it could do for my back it looks like one of those therapy beds oh the wonders it could work for my sex life am I right oh the things we could do the positions we could try out right reverse of on top and cowgirl back from the and the side from the hit it and it from the and how and his wife made indignant by such public displays of crassness cutting him down to size of More like get us both killed you fucking idiot think about the birds that’ll be circling this thing Hawks and Buzzards alike smell it from a hundred feet up they will what are thinking you’d be baiting your own trap it’d be your demise is all you’re just asking to get eaten which if that’s what you want is fine but please leave me out of it and then thinking the predicament over for a moment replies of Well what if it was dragged further in like maybe if we could hide it in the forest under some kind of cover or in a den maybe and the wife laughing her tone emasculating and bitter No that wouldn’t work either think about it we wouldn’t drag that mess in a whole foot before half the woodland creatures out there’d be lining up to snatch it from us all you’d be doing that way is trading Hawks for Owls and the husband silent but still looking facing the object if it could even be called that and the hard truth before him yes just a mouse is all and isn’t meant to be is it that it’s not the natural order this way for him to have nice things like this but Too bad he says Its got that perfect shape to it it’s not every day you find a perfect shape like that and that Muluk died seconds after his fall being a lot more chaotic than his brothers feet above head and vice versa mid air cartwheels all a-tumble that his death was not to be as straight forward as Ok’s though hitting his head as well what actually killed him was not blunt trauma but the snapping of his spine leaving him paralyzed for several minutes his face half submerged in water and with collapsed lung wheezing and choking shards of air he could see his left arm lifeless in front fractured in five places the radius bone broke and poked vertical completely stuck straight out of flesh that it looked to him just like the sun dials by which he used to hunt and that it looked as scepter of Kawi’l looks and not feeling anything consciousness didn’t last long but while it did was made of these two things seen the image changing from one to another at a rate akin to the kins and tuns of his heart’s final beats sundial to Kawi’l sundial to Kawi’l and that Kawi’l grinned at him as he gazed his skin as dark as eggplant like Venus blacked mid Kawil always looking like this is that his legacy is this too to have always skin darker than his own silhouette tells his whole history and that Muluk read it here in these brief final moments lapsing occasionally to ancient earth clock but is strange to see Kawil looking now lifeless dangling from his scepter and his body looking almost as broke as his and that dying there in the river Muluk thanking god for the life he’s had and for his brother’s too and to explain to you of sign of Ben looking like the day of Muluk and Oks funeral and who looks like their coffins of half Ceiba and half Chinese Balsa several feet under flat earth and twin suns hung above half gone into early evening black already that their coffins were buried for some reason vertical with their lids cross hatched is homage to Akbal’ and his eyes the honey bee it is hoped will carry their spirits from this world to next and to navigate through night house and made like sign of Ix looking like a shady possum or ghost and who is a sign born of thievery Ix who is a bandit of bone the marrow vampire of teal night and a grave robber as well that he exhumed the graves of Muluk and Ok and taking their treasures sundials obsidian arrowheads strings of bead and pelt that Ix sold these things to other denizens like to the sign of Men who looks as the end product of an long incestuous orgy that it involved many different types of birds is obvious including but not limited to definitely turkey vultures judging by all the wrinkles and extra skin of hanged mangling and to jiggle probably hens as well considering beak size and then strangest of all going solely on the blood shot eyes possibly a Bassett hound yes not a bird but still a pervert you can tell by how they look so guilty always and with blood coursing through it’s veins poor Men definitely not the most aesthetically pleasing of day signs that it took a certain kind of calendar priest to get past this to give Men the extra care required to really know him most opting to skip to the next to sign of Kib looking like sign of Ben in reflex as if like Ben of funeral day of those faux paddler twins Muluk and Ok were as muscle of Jaguar’s calf and in tendon and percolated Blood Scroll’s coursing to twitch in reaction again and to react is to act again as it was to act ever once and in this way like the Jaguar Wheel ever turning becomes tattered that it was only ever wind to reflex for and to flex again as to flex ever once was and of sign of Kaban who looks like Akbal if Akbal’s face were melting like the sacred honey bee his honeycomb eyes of compound to bee able for detection of light in infrared ultraviolet all visible wavelengths and forms dripping down his cheeks like so much melted birthday candle the old wax on icing and that if Akbal was for me the day I got to gently pluck the stinger from angeL’s leg and with resting her lovely head on my shoulder wiping sniffles away on my sleeve the day I got to play hero then Kaban must bee a day before she was there at all of dead days of her absence like of when I stepped on those bees in the yard the day there was brown bread in the kitchen all smooshed with blueberries into the toasted top and syrup with the yellow jackets crawling all over and that I accidently took a bite till stinging in my mouth pink-hot and swelled allergic became the cause of fevered hallucinatory dodecahedrons of Kaban faces pastel hued like from a grade school textbook hexing me in form of melt-walled song sung everywhere in around and under closed eye lids and then getting worse the slices of bitter brown bread and the rest of the loaf that it was taken from the kitchen while I was in the hospital and brought to picnic by Jailbait to be spread on blanket with yet more blueberries and jam too strawberry and apricot plus apple butter smells of sugar wafting in the air attracting still more bees and the afternoon bats that came down too swallowing up mouthfuls of both bread and bee sticking the insides of bat’s mouths throats and stomach black bats rolling in seizure on green grass that there was no one around to see their spasmodic fits rodent mammal mouths foaming epileptic and that I am here to tell you of Etznab who looks like a cross section close up of Akbal’s eye or under magnifying glass that it could also be a diagram of their bee’s sting or else a 2/3’s inversion of Lamat glyphed a closed off cousin in opposition to an open mouthed mother wife or sister the delegation of space management thrusting toward negation the shattered glass sentiment of a bad tripping the crack in the pot the bad in the egg the anxious enlargement of such hostile patterns and of Kawak who is the only sign to significantly compromise the shape of it’s borders that Kawak has a sort of peak curling inward and markings within seemed mirrored of cellular and amoebic that such a sign would appear at the end of the list we could probably rule out any reading based of evolutionary chronology unless of course its supposed to be as in those Hebrew books like backwards of read right to left and top to bottom and that I’m here to tell you of course of the last sign of Ajaw the final day the last act the epilogue and prelude to the begun again of Imix 1 and Ajaw as the only I can say I’ve seen up close and in person the only I’ve met and shook hands with and that cheek to cheek we told secrets of hot breath spicy like ginger root and lack of sleep a little dehydrated and that Ajaw to me looked like a clown at first I’ll never forget it the same clown from the picture book I was read as a little girl in Moscow all the same shapes were there the white eyes the red ball no se the mouth and yellow hat and that in Ajaw they were placed differently didn’t matter as I knew who it was right off of the first time I saw this sign being in the reproduction of some glyphs from Palenque I had had delivered to me while I was at Harvard Oh those months of lonesome and grueling study in the department’s basement of course sort of tranquil as well but disturbed that I started to see blood everywhere in the iconography decapitations stabbings figures with wooded belts fastened round their waists for burning for making of human pyre a woman holding tip of tongue between fingers just like Manik sign and piercing through it’s viscera like all the way through like Kimi sign with tongue as wisp and rings as wound and that she pulled through this gaping a rope fashioned with thorns imbedded and forced through tearing away more and drawing such torrents of gore and that I was thinking about these people doing this and writing such things thinking of their violence and depicted of the writing of violence and it there plentiful in just the act alone of to write is to struggle against Kawi’l on his scepter but his scepter to still stand in this erect and silhouetted in front of blood brown sight crest on a Scroll sugared morning wetted of essence dew and with smoke billowing out the forehead while he hangs is like thoughts do ribboned seeped in air space and hanging like thought itself to inhale is to surrender all to recognition and recognizing both in thought and in smoke such gaps between thought and said enormous and ofter pained that such spaces are tested by trial of catastrophe all seemingly hand made as if by a collective thrust towards always a collective thrust towards I thought as I colored in Ajaw his hat yellow hat nose red and two eyes blue light leaving his mouth hole uncolored I thought of words also pregnant with themselves like empty days in Ok’s eye and that they are like jewels also like Eb’s ears are that they are like treasures too stolen from Muluk and Ok’s grave and that they catch light like Lamat light of dilating birth and of these words and the supposed gaps that words will fill this too words filling the gaps between words like the people who wrote them the people who made such Stelae and statue who wrote these books to fill the space between words and stars or maybe something more maybe stars of stars that they have to have like living out in the jungle in these cities made this way that it is what they did and how it came I have to wonder what the fuck that was and that they must be more like pots or jugs than people such as to be filled and drank from and to water crops and maize yet still crafting their own jugs and pots they smile stare into vessel that they become warm in their own of such vessel-ness they too are decorated this way with Lemon-brown Jaguars wandering across plains connecting one thing rightful to another is that this is everything and the Jaguar with his walking towards and strutting did they see him in their cities will they were they visited and why and how is what I am here for for you to answer me by either of word or deed we’ll see what harvest the seed of yours may bring and finally the voice stopping and in the new found silence Jaguar Pants considering all she’d said asked then about Ajaw and of what he had said to her and that brief but exhausting moments passed slowly like a candles petite burn steady there in the cavernous drywall where he stood this woman behind the voice revealing herself walked to him and walking towards his walked towards classically lovely and demure her hair styled in a bob short and curled she was slender framed with a serious face plaster saint skin beautiful hazel eyes and mouth saying says to him Hello it’s so nice to meet you face to face my name is Tatiana but you can call me Tania all my friends do and Jaguar P just staring not knowing anything in the way of formality or manners but figuring and fidgeting should say something tells he’s happy to meet her too shy offering smile and she asks his name but not knowing he just stays quiet and still till That’s ok she says and seeing he’s not much of a conversationalist takes the lead You’re very handsome and seem quite honest in heart and intent she says But I’m afraid I’m not going to be able to answer your question and for that I am sorry but it was something told to me in confidence the sign of Ajaw being most secretive he made me promise I would never breathe a word of it to anyone though I’m sure it’d have been the same with any I might have met out there and though Jaguar Pants has a guess as to what Ajaw told her he stays quiet about that for the moment instead inquiring of where it happened It was on the boat during my first trip to Guatemala she says and I was so excited but also a bit sad as I had just said goodbye to my family and didn’t know when I’d ever see them again especially over my father I was quite melancholy him being away in Siberia for work I never got to give him a last hug so I was thinking about him a lot there standing on the deck of that boat just looking out over the Usumacinta when I noticed voices behind me and turning to find a tall figure in purple robe and rope tall boots laced tight was someone I hadn’t seen onboard before and that he was a Jaguar as well I almost leapt from my skin that he had ribbons of something appearing to be as pink silk stretched from the back of his crown down over his ears and into the eye sockets thoroughly tangled and introducing himself telling me his name as was Knot-Eye Jaguar the first and that he had been the ninth king of Yaxchilan he asked that I forgive his appearance and explaining to me of his ailment that his vision yes in fact knotted and for him to see at all was extremely difficult that it meant the passing of light through a labyrinth like tangled as calabi-yau of ivy and thorned at every turn but that he had witnessed in his years several transits at all is a miracle even if her passage to him appearing always as fleas jumping round the surface of a flat orange dog so blurry and like Creamsicle all wicked witch like mixed with a dog’s back or else the rest of the year Helios shook and strobed all over the sky as the needle of bi metallic thermometer in burning milk does like zig and zagged as special rave lights in club Lamat is so much so that Knot-Eye the first ended up in an asylum and overcrowded and underfunded so that there wasn’t a separate ward for children so that he was grouped in with the adult crazies and as a psychotic he would be bed rid for many transits to come getting up every now and then for to empty the old bed pan take a jog round the grounds walk the courtyard talk to the trees azaleas and pinecones to eat lunch by himself at the picnic benches wooded of Ceiba and drinking out the old thermos building up energy if only for to concentrate on never to look at the sky again and all the terrible things that would bring the other patients so cruel sometimes tying bird bones to the end of his eye ribbons while he slept then waking in fits shouting to his doctors always that Ajaw had been the one responsible to make his eyes this way he needed to have his revenge just as soon as he got out of here and Ajaw guilty as well as being the final sign of day responsible as well for birth of K’awil carrying in his sign K’awil not yet as sacred statue but as living babe naked and held in arms held as smeared in oil as streaking of roots of Ceiba streaked every nightmare of every sign prior like a motor driving Kimi to death poetry and Lamat to close like Manik hand to be shot in mid pinch like Akbal to choke and drown in swarms maybe like K’awil skin darkened through the day to spray on his hive the oil rain as liquid as obsidian and Ik to not see her own floating cross reflected and Muluk and Ok never dead never shoved of over from cliffs precipice to tumble to Eb and Chuwen never to pulse and utter that they are white ghosts of hollowed morning stars never to be lit made only to empty themselves of the day dim and skeletal and cracked as plastic well Knot-Eye on the day he woke to this curled quiet on his mattress in the nut house with one arm reached forward palm out happening somehow in his sleep feeling as both legs wonderfully broken forever useless and felt squeezing lids shut felt the light pregnant in his eyes deep in there and despite the being behind all those knotted fallopian’s believing the birth still possible till daring to open them again raising upward from floor to window sill till gazing higher seeing for the first time the sky tooth at a lean overhead the great white cavity turning and making a promise to it vowed justice for their terrors of night plagued upon the citizens of the signs his own cracked constitution yes but enough for to crawl and crawling out his room and through the garden he began all the while bringing into his revenge everyone and thing he came across assimilating to his bitter heart of like bitter brown bread as Jaguar brings glows into pants always by walking always ever walked and ever walked towards ever floated towards and crawling further to gardens end that he left a trail behind him of his fantasy sticked sticky and sweet excrete excremented like in fashion of snails does and moving past the perimeters of asylum grounds and into free land massaging like into sacred bath like of rainbow blood prickling in his veins to rise to walk and to this vessel as stowaway that tonight he is here has made it this far as per the plan having tracked Ajaw down as far as Piedras Negras just so happens to be the destination of this boat and that staying true to the course he took me as his (somewhat willing) prisoner on shore with him seeing (something like) potential in me he said and guiding him along the banks and through foliage to the entropied structures like passing through the warm dust of the F group encouraged me to invent my own vocabulary to do it from the gut and to listen always as well like mix techniques of the synestesia precedent made like

Vowels- A Black E white I Red U Green O Blue vowels I shall tell one day of your mysterious origins A black velvety jacket of brilliant flies which buzz around cruel smells Gulfs of shadow E whiteness of vapours and of tents Lances of proud glaciers white kings shivers of cow-parsley I purples spat blood smile of beautiful lips In anger or in the raptures of penitence U waves divine shudderings of viridian seas The peace of pastures dotted with animals the peace of the furrows Which alchemy prints on broad studious foreheads O sublime Trumpet full of strange piercing sounds Silences crossed by Worlds and by Angels O the Omega the violet ray of Her Eyes!

with the grammar school afterthought made like interpreting of pictogram as simultaneous scene and word to take image as logograph with the syllabic as well of synharmony ending of in echo vowel that it was carved this way but not spoke as into Jade and stone of vase and Stelae and related so direct to the hand of whoever did that it could be the entire makeup of their body writ into stone as much as the dates they carve and that which they carve into could be the makeup of times body writ into void form but from where from and like just as I am to you to Jaguar pulse and Jaguar Smoke you are them your ancestors and your dead the broken kettle or urn smashed ceramics in space and in action in space and inaction in space in action spreading apart to signal ceremonies close that you’ve crossed the line of knowing you’re pulse in this place and this place in your pulse to have to abandon in order to read is ok that’s it’s just finding you’re way home isn’t it and who could hold a grudge for that was how I explained it to myself too with Knot-Eye forcing me deeper into the site the forsaken city all with walls like sand-dollars and dirt soft like dead and with a razor hunting knife he kept wrapped it was in a hand towel that he said I had to keep on else he’d drive it in my kidneys and to apply this way of reading to everything he said do it always and now to the architecture the ball courts caves the great boulder near the river signed Yo’ki’b and to the panels and Stelae boastful mostly of political prisoners and war games neighboring rulers held captive and tortured and like Hey Knot-eye this one kind of looks like you come over here this one looking forward the head ornamentation all like fountains and glyphs constellated above his head look how the rope his wrists are bound in mirror the Knots in his eyes and obviously hitting some kind of (probably equally tangled) nerve with him Knot-Eye looked down and mumbling Look just keep walking till I say so and on we went treading quiet through shadows cast and crossed of still more Stelae monolithic and imposing but something strange that they are most definitely defaced and appearing to be deliberate too and more panels too seeming as ruined intentionally but only those with glyphs pertained to the lots of kings or deeds of rulers and with all those regarding deities left in tact it seemed to me the vandals had been literate in this script perhaps maybe suggesting the abandonment of this place by it’s people that it was them in fact who did this to build something to destroy so for the eyes of seated Jaguar Gods to grow larger that the collective revision of a revolution could I see it as resin sticking as pine to the Ceiba and stone surrounded well certainly not being able to bring the matter up with my walking partner/captor though I suspected so much that he was withholding history to me here all as what happened to him in this city of what romance glory or tragedy does he share as secret with this place and how in his heart was such a secret knotted like as being two ways to make a knot the first with precision is done like of bringing two ends together and running through in sequence the steps and to practice and know these to execute with skill implying inherent respect and reverence for spatial-physical properties and the faith of abandoned symmetry for order that the symmetry will remained unseen and to reinforce by way of procedure like rote like automation or else the second of taking the same two ends and rubbing together simple like haphazard till tangled chaotic of rubbed together with Manik fingers or even palms like what of Manik’s palms anyways and that rubbing a mess can produce sturdiness I remain skeptical though plenty try it and of which persuasion did Knot-Eye adhere to I wondered while we kept on forward thinking finally only of the string itself and with no knot at all to enjoy it unknotted I thought of like holding it straight slack above earth’s ground and to roll the wrist and watch it shake to witness harmless vibrations and how often times this could effectively attract kittens to paw and catch kittens fur white as Jaguar Pants glowing bright and caring as snow and wondering once more will people ever speak this language again will people ever write this way again like to make tunnels of their minds for Gods to travel through as worded in shape of Jaguar and Manakin both and standing erect and forth right never to waver in the task at hand of hand never to peek or peer back into such a tunnel to look into tunnels only forwarded as the only virtue here and that it is the key to this city I was sure then that Piedras Negras could be explained by this and that there were examples all around but only one ominous exception the nearby sinkhole of chemical dissolution of carbonate rock or ridge or else suffosion processesvaried in of sandstone that that we came to as night fell like of Venus as evening starred far out to outskirted like mudded terrain of the suburban Piedras Negras and that it was here we found Ajaw hid sitting alone with back to trunk of Ceiba and holding his right leg up near to chest as close he could with the knee cap pressed against the shoulder his foot hanging limp like a Manakin while the left remained suspended without assistance gripping in his palm a bulbed syringe made like from where we stood hard to tell but most likely tree sap milky then dried as from rubber tree or else latex tree perhaps also made like from fish bladder or turkey bone and aiming this towards his spread apart breech the gaping hole between his legs that I swear to you was made like crater in the earth basin of Kan made like abyss of obsidian blacker than the native suckhole in sight and that as we approached a shimmer of ecstasy rolled over his clown face like light or glow crawled across Jaguar Pants slow always slow and that squeezing the bulb water squirting from the stem made like fermented cactus fruit agave maize kernel and century sap shot into ass crater like the coal kiss of an angel to forehead of sinner made like fermented honey from bark extract of balche tree made like seeds of the white flowered morning glory and eyes rolling back in ecstasy he started to talk to us his mouthole pink and wet moving like a slit in the leather casing of a book moving like the mouth of a puppet of a slaved Manakin and babbling all in hyperbole to we two looking us land of the dead in our eyes he told me that I was smoke and that Knot-Eye was fake smoke Faux Smaux he called him and laughed and exclaiming You’ve seen the Sky Tooth then as well I take it and Knot-Eye saying nothing letting him continue Yeah you’ve seen it I can tell it’s written all over you well you know that Sky Tooth that’s you buddy every time you see that Sky Tooth overhead turning all slow like and turning as the geared calendar wheels turn or else like music burns slow well that’s you old buddy you’re the sky tooth and while that’s all well and good you know it’s still like you’re just an ordinary sky tooth despite what you may think but this one right here this one- and with this he pointed at me- She’s a Sky Fang she’s an absolute a Jaguar fang just poised up there so pretty and mesmerizing so daunting and regal and turning so fast she just turns and turns like the end of a drill or something just drilling all into the night sky oh and that’s another thing too is that you’re a Sky Tooth that’s just out at day you’re just out when it’s white against blue but this one here she’s a Fang in the night and she glows hard as the stars do harder even and at this point it was obvious how high this guy was but you know I was interested I was a scientist after all and so I asked him Well hey look what is it you’re doing here and pointing at the bulb he held and had been flooding his southern cavities with Oh this he said Oh just a drop of the old ritual enema cause hey this is the best way to do it ya know like taking it in regular is for suckers it’s like fake smoke it’s like Faux Smaux over here (pointing at Knot-Eye) but this (holding his enema syringe up for us to see) this is like the real deal Smoke of the smoky Sky-Fang this is like the best possible way to get high ever and it’s the only way I roll now and it was at this point that he paused and Knot-Eye and myself exchanged glances till he (of course) spoke again saying See you’re only the Sky Tooth right and you turn slow like music and that’s all good you know like hey music is good right but hey guess what you’re full of cavities too because hey there’s a downside to things too to everything there is there is one downer for every up always a price to pay and you know like hey you’re gonna get cavities this way but guess what you’re in luck cause you’ve got this friend over here that she’s a Sky Fang and she turns fast as a drill like a dentists drill right and she’ll fix you right up but you know for a price like maybe cause everything’s got it price you know and this went on and on this Ajaw guy talking this way his bloated clown face colored queasy and nauseous shaking and puffed till Knot Eye sinking his blade in as to deflate forever words and body and oh the squirted streams of blood like cinnamon mudded raspberry wine pooling on the ground in front of him sitting stunned with enema-baster falling out his asshole and the look of total surprise upon his face the glistening of ever widening pupils that Knot Eye had really got the drop on him and following it up with unrelenting stabs to the abdomen and chest cavity the general upper torso torn into with blood gushing everywhere flood of blood becoming everything like to Ajaw then of his world of bleeding and fire like pained tongue banged of sun squirts of blood into eyes as blood shine against Eyes of Knotted and eyes of blood light I’d take Knotted any day and with final bargain words coming from his mouth suddenly so reverent but of begging for to spare me and I’ll tell you everything and Ajaw leaning to say What could you possible have to say to me but allowing to be whisper wrapped into his ear a gift of he later told me great surprise though still killing him of course turning his meat to monkey bread and butter of blood till dragging his tattered corpse to the sinkhole Centoe and dropping into that we watched it swallow head first like uncomfortable slow and bubbled to snorkel with the pots and pans or whatever else statues and idols what have you done away with their and really slow like both of Ajaw’s feet up and watching the swallet doline swallow hole of his ass descend thinking how strange a way for the calendar to end for this last day to disappear this way and into the next with this last of him consumed there being a gurgling of three bubbles that surfaced together clustered like spheres of Imix and popping in such a way like middle full and left and right crested half and popped that I had to laugh I imagined an hourglass used so much over time turned over and back again top to bottom and bottom to top so often as to turn to sand itself and I had to laugh again like swallet hole of Jaguar palms waving void and at this point that Tania closed her eyes and looked down to smiled snug in this memory and shook her head as if the pleasant surprise return of a sensation long forgot or assumed never to be known again a feeling impossible to translate even if she’d wanted to share which she didn’t anyways and with Jaguar Pants watching her all the while like she remembered a little longer then and opened her eyes as he stared into them like eyes serene and unblinking of hot Caucasian glow of a Serbian nymphet of Bait of Jail pupils black as black cast iron of poker ended to stir winters coals till in snowed in Cossacks of animal smugglers den warm vodka and cigars till finally Jaguar P. forming a guess as to what he thought was of the end of her story and presented it to her of that what Ajaw had whispered to Knot-Eye was of truth of who was it who were those that killed Ok and Muluk and then making a second guess that he had let her in on the secret as well after they left that place after they walked back to the boat and set off away from Piedras Negras and she took his Jaguar Hand in hers and they walked for some ways through the tunneled walls of that hospital he’d all but forgot he was even in and after some stretch of silence indeterminable he asked her again was he right and she turned to him and said No you’re not right you don’t know a thing and he said Well why what happened then and she told him Well for starters I never left that place I never left that city or even that swallow hole that day and not understanding he just stared at her and she said it’s ok just keep walking if you want to know just keep walking and you’ll find out and she pushed him forward till they came to a wall he wouldn’t have known was there had he not touched it white as it was like everything else as white glowing winters path to put his tracks into pushed through by Tania to paw print grey black all over till breaking through second birth of walled Lamat signed like Venus glyph spitted him unto the mountains top of the same it’s always been known and told of he was raised on with his Lady Jaguar surrogate mommy of grace and kind that it all faded like pastel of chalked wetted sidewalked washed of off with even not a scar for keepsake as he had not been hurt at all for it and so had nothing to show or hold and so carrying on as simple that he wore the beard like all Jaguar children wear like he loved so made of gray fox hair and would take it off only to bathe and even then having the urge would make a replacement of bubbles and wear that splashing around with the woman she was kind to him for company and would bring him treats from down below toys to play with and Pinkberrys medium sized in Styrofoam cup all with whatever topping his Jaguar heart dreamed as such a lovely childhood that ended the day he came down off those peaks not yet wearing the Jaguar Pants as being only a tween then was when he saw of in Tikal saw twin Jaguar babies being of public sacrificed all at the altar like with the people crowded looking up in awe of faces fielded for that there was the jade bowl dark and shaped to hold the babes above while for the cut of young throats a hollow basin to catch the blood drained out to of enlarged orb of Obsidian cut black like dancers pants black like watermelon seeds and black as dreamings of sunned and sun of watermelon seed of a candied seed hollow and mute floated in clear ocean all with masses of kelp like black beds for not sleeping but getting out of dream terror with its seeds only been eated as by discriminate sea life of whale shark and porpoise and the baby Jaguar’s wearing their fake beards and crying out for helping and a gentle old morning star woman in the front row humming softly to herself the melody of the Jaguar Came Tumbling Down The Mountain her verses writ of pure sorrow the people nodding along swaying humming too and that there was so much blood that it must have been just like what Tatiana had told him of murder of Ajaw in cold vengeance or else Muluk and Ok pushed to Pineapple rocked crags and that these names were the babies names too as was announced by the priest residing as it was that kind of ceremony of sacrifice and begining to cry and scream looking at the body’s of the executioners youthful and tanned as freckled on shoulders all with tight abs and shaved chests 3 sets of 33 sit ups every morning noon and night plus going swimming often the butterfly stroke and breast dolphin kick and dog paddle wearing macaw feathers and baby Jaguar pelts some naked their bodies painted white but not white like the glow of the Jaguar Pants white like some kind of flour or ground maize white like caked on to their bodies and all of this annoying and offending Jaguar Pants as one held out the lifeless corpse of a baby Jaguar towards the crowd Jaguar Pants beginning to uncontrollable weeping again watched as the carnival death of his own though not able to turn away and the handing of the corpse off of to a boy he must have been as pupil being still a tween himself carrying to a rack and strung up to begin the process of drying out of and skinning saying you spread the Jaguar’s pelt and it’s as though you spread the heavens details of a starry night his teachers had told him and everyone knowing that they said and with the rack standing in arched between two Stellae two different versions of the same story the hero Twins the Paddler God geniuses as imagined by two artists a young and an old like they are of till still standing amidst and behold of of of of of of of of of of of of of that Jaguar Pants stood thinking back to his dreams had as child babe Jaguar boy of rows of rows of Jaguar kins singing COME TUMBLING DOWN in melody of tons of tuns of harmony vague as years of evening stars forgot as by hundreds of them all his unknown and unknown lined in front of central plaza grouped that at the front lines were older Jaguars killing young shooting their Hands Shot to grinding into like little flakes of like shredded coconut flake topped of Pinkberry like into finer even of mounded powdered of crushed Molly Appled Molls in creased of binder paper to dip in fingers tip or mounded of birth control pill pink-white circle tabbed of tranquil medicinal calendared rectangle litmus stabbing into their bellys like sheets crushing their skulls with rocks and the horrid screams of and music to sound tracking grotesqueries was always was when he woke up scared out of his tiny Jaguar mind but alive still to jump into the arms of the Lady Jaguar Priest the Lady daughter of the sky so kind to him and the Lady daughter of the sky tooth that she would hold him to run her fingers through his fur he would close his eyes and open his mouth that she would breath so close to him tasting her delicious air all of almond and rain and batter sweet and sky was good that all was good so long as that air was till not now till now she’s nowhere here no and hung in his heart nerved of tattered opera stringed singed tearing tearing rip drop but maybe still in fire heat was in the still part still was her or else in the forest that maybe traveled through motion less her lady ghost lips will still be to kiss his now all Jaguared and soft again probably never more thought of while running from acropolis and into the obscurity of the green life lifted fauna-thick of which he would not leave for several years orchids of hand-pollinated abound around his cave life living styled veiled heavy Jaguar lids morninged weighted openings lift and bits of mites and minutiae sheathed in waterfalling like jars of his owned piss kept everywhere with jungle snails occasional as was Jailbait frolicked free of crème skinned long legged boot wearing lead to of churning pitted Jailbait waters sub den damp but from where he couldn’t know skittering by in hot pants and tube tops all scavenging as for birth control and ringpops till hearing sounded their wild squirting from miles off as pitched of fingers pressed pleasing pleading sweeting till sweet young thing of butterfly Squirts torn of chrysthanium like supposed infinite gestation Squirted through as faster than any and Squirting as such down by and all over the banks of the Rio Dulce the sweet river the carmel river into the body sometimes out of the body and into of water streaming into the stream Squirt mind you of actual landed Squirt stream of pearl drops culminating in like that and that once he found himself bathing in such and as they were doing this that hearing them this day like heard howlings filtered by Squirt reverberated through trees like howler monkey bark and crouched down in the water waiting watching opened mouth like oh to wait until he could taste it the downstream squirt it was candied and feral like the sun and Venused handshook mid-transit or winking only the sun to see Venus as white pupiled and glowing then of the view for every all black as obsidian observed winking arrowheads blacked like blood of Venusian Hands Shot and that it tasted like circus sticks flavored of once seeing a doubled Venus in the sky two Venuses and wondering what it could mean and that once he saw a two pronged Venus and a two pronged sun looking like shark dicks floated above him and seeing saw a triple Venus reflected of the surface of a jar of his own gold piss he walked and walked sure as a see-saw and trying talking to the Jaguarundi to have his questions returned with concrete stares and occasional punctuation of dumb blinking till one night another dream this one of the Jaguar Colossus mighty and strong stood in front of a solstice sun but something wrong his body struggling as it was as scaled by thousands of tiny Kawi’l Manakins digging away at his flesh all with pick axe and shovel lust like lusting for the smell of ginger roots inspiration and saliva of obscure tastes of Kawi’l that there was Jailbait too lined up to lift their baby doll dresses and to lower tights all to arc squirt onto the Jaguar C. big dreams of wearing away to squirt wild seed softening and saturating surfaces that they too crave to destroy squirting in great surges aimed with astonishing precision and the Jaguar Colossus amidst it all having ceased struggle against these looks up and into the eyes of the Jaguar dreamer says Do you understand now? says This is it is what time it is and where it has fallen snapped broke and crumble dusted like falling and lies it has here do you understand and do you really know you are watching and how special it is all just for you is all I can say and hold on to me sun and hold on to me night hold me tight Venus and before he could say another the Manakins like a swarm around his head dug away at his face his mouth as well being filled with squirt so full he cannot talk gargling squirt as wished and Jaguar Pants when he woke knowing not what to think was ill at ease for days went walking puzzling over the enigma of his dream seemed strange and walking away that feeling of scope of possibility scoped out there waiting should be growed in proportioned to gazed should it not and proportioned of length of walk as well that it should be grown the further out he yet for some reason not and in fact couldn’t help but notice the walked towards become more narrow as more specific like all of mass growed around a single point become faster than the walk of it’s own concrescence like 13.0.0.0.0 times 2 waiting to crest like such a point become smaller all the while attracting still as though a principle point luring asking only for him to debate it impossibly so impossible to decline such invitations no debate to give in of natural feel for the attracted feeling the spot of felled feeling attractive asking was he that point there the narrowed and blanketed pumping Blood Scrolled with percolated rainbowed oh iron knowing now how the Blood Scrolls were written as to be admitted to the Blood Scrool Temple there only would be known for sure there of Jaguar and Blood and Scroll and Pants and walk and Shot and Squirt and Hands repeated repeated repeated deciding them to be found and set out till one day coming to a tunnel near river’s end of entry point for very old aged and aging storm drain seemed as if taller than he would have believed if not to have seen for his self void copy catted Jaguar echo strut all left knee right to this walking of the second darkest darkness of his life blackness black as Kawi’l’ed hands melting black as Venus shadowing mute and circumcised by it’s reflected castration of mirrored like as of an ice planet imagining a cloud of piss froze to sphere and grown black into thing or no not or into Kawil hands with fingers symboled in peace signed melting and telling stories as they’ll do so well as hissing at this time storied of tunnels a tunnel as this is being walked through as by a Jaguar Pants and above him with shafts of light breaking on occasion from overhead right angled frames lined with dripping swamp green algae watering droplets slid in pearled orb bottom heavy down their lengths into thick frosting black mud squished tween Jaguar toes as he walks and crooking his neck to look about there the rounded concaved coils rivet in this ancient metal meant as to channel rushing storm waters and the diseased puddles left behind in his footprints breeding grounds for protozoa various germination all of eukaryotes free swimming motility all and getting deeper and thicker the moss and wet hanging muck soft and damp stalagmites grown longer and more tangled to take on more and more the texture of hair and all like increasingly unnatural colors occurring too oddly autumnal for how damp like tangerine and brown then more vivid blues and yellows acid peach and acid salmon like dying salmon leapt upstream and vomiting rotted peach almost the last of his kind liquid heliotrope in arcs spittle and bile of fish guts chunky though it’s not just the color but the surface area covered as well when before it just hung from rafters of edges oxidation tin all L in L in the damp areas now virtually everywhere up arced aced around and hanging tangled torn and puffed spread growed crawling moved moving more than he is doing so lonesome though thank goodness he was not alone in there that there was some life in the drain mostly just insects but still better than no like most notably were the Leaf Cutters Ants at not a bad for distraction that he could talk to them ask questions wonder aloud to when he first noticed them about a quarter of the way into the drain a line marching down the direction his opposite walking towards from where he had come his entrance point and carrying the standard assortment of leaves with them a couple of sticks nothing too out of the ordinary some flowers blue forget me not and morning glory possible lavender a few dead bugs grasshopper and bee whatever they could haul back to her majesty the pregnant queen age slut but going further as he went noticing their cargo seeming stranger seeing them carrying chess pieces Knights and Bishops all white except for one a Black King couldn’t make him out at first you know bad lighting in the drain there black as Black King he saw them carrying chunks of Opal sugar treated by cane or confection carrying long candles long and waxy of candles candled in shape of Bert and shape of Ernie shaped of and of Kawil plus tiny birthday candles and hand candles black as Kawi’l and unshot with index fingered wicks of every possible combination of digits held up and down the singular point with each digit peace sign thrice fingers four and five thumbs up thumbs down thumbs out hitch hike hang ten rock on the shocker all that shit some of them lit some of them melted down already to palm or wrist some melted so far down the ants who had been carrying them ending up literally encased in the melting puddle dried and buried alive only to be found and lifted again by another tribe of leaf cutters blissful unaware that they are part of a funeral procession Oh just doing my job they would say and oh for where your death comes from to be as well your casket how often does that happen in mudslides perhaps or earthquake maybe or else building great like wall of China pregnant of S K’ul sk’ull essence till of one point seeing them carry the entire corpse of a monkey too far rotted to know for sure what kind of orange-ish fur tangeled fearful split ends and hollowed eyes sockets passed by wondering how many Leaf Cutters it took to carry it probably five hundred is his guess and watches it pass by and just when he’s thinks he’s seen it all a Leaf Cutter crawls right up to him looks him square in the eye and says Hey you think that’s something huh well that’s nothing we can lift buildings to if we want to you know one time we even got real organized and moved one of them Blood Scroll Temple’s yeah one of the concrete ones it took thousands of us but hey we lifted it right off it’s foundations moved it almost fourteen miles away and Jaguar Pants stunned says hey now wait a minute you can talk and Yeah the Leaf Cutter says Yeah I can talk alright what’d you wanna know and How come I haven’t heard any of you leaf cutters talking before he asks Well I suppose it’s just cause we don’t really got time to talk you know us Leaf cutters we’re pretty busy after all gotta make the Queen happy you know how it is in fact hey look I should probably be getting back to work right now I’m sorta fallin out of line here just talking to you now it doesn’t make me too popular with the other ants you know what I’m sayin and But wait I’ve gotta ask you one thing Jaguar Pants saying You said you moved one of the Blood Scrool Temples before right well that’s kinda the whole reason I’m here at all in this tunnel I mean see I’m trying to find the Blood Scrool Temples as well on account of I wanna know how the Blood Scrolls are written know what I’m saying and the Leaf Cutter kind of looks at him sideways and laughs Heh heh yeah pal I know I know what you’re saying but hey look buddy who doesn’t want to know that everyones trying to find out about that ya know but look I gotta get back I’ve got responsibilities here obligations to the Queen she can be a real bitch if she don’t get what she wants the old whore she’s about to give birth to an entire colony any second now understand and if I don’t get all these leaves and shit back to the nest well there’s gonna be hell to pay and with that he was gone scuttling off to who knows where and then not too long after his departure was when the storm drain began to seem as shrinking uncomfortable narrowing and that as it narrowed the number of Leaf Cutters started growing exponential and eventual as when the ceiling above him to get so low he had to crouch down and crawl on his hands and knees just to move forward and how uncomfortable and impossible but that this was also his first seeing of the lights end of tunnel so franticly he started moving excited and scared of how and crawling through Leaf Cutters now and moving mass twitching could feel them so many and squashing breaking crushed under his weight were biting back and scaling like his arms and back and neck some trying to get into his ears swatting them away choking and screaming and Leafs and mouths stinged pinched stung stunned red and bulky SO close to him and to end now of tunnel inside and out bites and in the middle of it like the white in the glows like the pink in the berry like the Shot in the Hands and the birth in the control in the pills is as like the in the ( ) is the thought as that this is just as the dream he had of the nightmare of Kawi’l’ed of times flow Manakin plural scaled the Jaguar Colossus cutting him into little pieces his heart so broke so badly that approaching the end to begin to hear things could see shapes moved of the diamond in Lamat light narrowed so as to squeeze his body no further with the drain closing in so for all that could fit was a single arm and with fingers extended just short of penetration reaching in a bit further still till his arm stuck and panicked with Leaf Cutters now crawling all over the bottoms of his bare feet like some Chinese torture genius of wall building of pained burning within the march of theirs aching from marched like praying for relief of Jailbait to come and Squirt off these ants to wash him clean in Squirt cool and holy and heal but the living swarm now beginning something he would be blind to but to turn out as personal cataclysm forever to change like beginning to bring for him the objects that would make up the fabric of the Jaguar Pants that which he would walk towards and to be his glows and the glowed towards beckoning to the Jaguar Pants he was forever to wear the Jaguar Pants he would walk in for the rest of his days and that would glow and that the Jaguar Pants would glow the Jaguar Pants glows and impossible to know how to know if the Pants were brought as complete entity already made of the Leaf Cutters gathered that would be the walked towards or if assembled on the spot made of piece by piece right onto legs of sewn as Leaf Cutted all of possibility equal to the glowing and Jaguar Pants himself knowing never which that this is not why he walks that the Jaguar Pants walk on their own accord is important that Jaguar Pants just wears that there is Jaguar Pants walks and the Jaguar Pants worn the Jaguar Pants glows and that of the many things that are of the Jaguar Pants that make the Jaguar Pants glow there is most prominent at the moment a key placed in his right pocket that he can feel a cluster of Leaf Cutters take their time in getting it in there the fruits of teamwork for his sake but why and for a key as well that it’s blade is long thin and three pronged on it’s end like an E is it’s bow a perfect ring of silver hollow like Kimi sign to turn what he has a feeling he’ll find out eventual that another reward if managing to survive this little era of accumulation he’ll win and that it’s an accumulation of many things Leaf Cutters unanswered questions and water thankfully now gathering behind like concrescence light faster than in zero pointed pit 13.0.0.0.0 to put out the burn of his foot made like Pyre of ant bites Jaguar flesh cut like leaves soothed like aloe to sunburned or toothpaste to bee stung and also the caked walls crumbling the foundations he’s found himself lodged into weakening so as for him not to ask why and where this water came from but only thankful that he thinks he’ll go back out the way he came pulled back to the forest or even back all the way to Tikal would be fine but is wrong as the gathered water surge having other plans sends him forward by way of rushed tide till finally with the aperture breaking by streaming made of shooting forward through pin hole black he is Squirted through the wall and washed to an unknown room dim and damp and from the looks of it subterranean some kind of basement though of course built of material and technique unknown to him that thinking to himself This is the strangest thing yet the room already flooded all with several feet of icy water he is dragged through and into pushed by wave and slammed against the wall rolling over to set himself upright and stand observing his new environment sees there are shuttered windows looking out over a driveway and a neighboring house wooden stairs leading upward to dark framed shut door and sinister appearance of water heater in the corner several cardboard boxes containing what appears to be old yearbooks soaked and destroyed an old chair with a plastic yellow raincoat and most surprising of all is sitting in the center of the room a young girl looking upon first glance to be seven or eight years old black haired and securely fastened by rope to a plastic potty training chair she is wearing a red and green flannel skirt white button up blouse and a dark blue wool cardigan and breaking his heart that when she looks up at Jaguar her eyes are filled to brim with pleading of Get me away from here and Help me and that before taking a first step saying anything or asking a single question either to himself or her knowing by instinct alone that this room is flooded not just with water but by sadness as well palpable and real that knowing what he’s wading through to reach her might not be a pool of shed tears in the literal sense though might as well be and should be and sure enough there were some real tears there in there too that she was weeping then in fact as he walked towards and to no surprise as well that hot Jaguar tears were falling for witness of this stolen childhood so as that hardly can he take the sight of it comparable to the crying one does in a dream perhaps that the girl is actually thirteen he thinks and she jerks when he gets too close and sniffing at him like an animal does as when he walks closer to her sniffings at his hand as he unties her ropes till lifting her limp body out the chair she is all but a ragdoll in his arms and the Jaguar Pants glows that together they walk up the stairs towards the door as the door becoming the walked towards the Jaguar Pants glows upon finding it locked and not knowing what to do the Jaguar Pants glowing like the Jaguar Pants glowing and that digging into such pockets he produces the key long as ever and gripping it’s blade and turning the bow of pinching it’s handle like Manik finger as like invisible homage to that esoteric honeymoon Tania told him of such a day of deflowering of day signs and still going along with it he carries delicate she child victimed across of threshold in exact of stride for stride in keeping with the calendrical forebears he remains arguably naïve to as in so far as not being in the front of his mind the Jaguar Pants glowing like a Christmas tree till reaching the muddy grass and lying her down goes strutting off in directions unknown though turning out all circular this being the first taste of what’s to come the endless leg fits the spasmodic servitude he would have to adhere would have to give in to these Jaguar Pants for the remainder of his days his knees rising suddenly in jerking motions jarring the rest of his body carrying it along like riding out a storm with no sails and helm held to leeward that the Jaguar Pants were walking now to nothing the whole lawn as the walked towards Jaguar Pants dropping to the ground and then to roll and stall to drag himself in clockwise against blades of filed of sun dial crowded not used to it at all yet and with all the while the girl watching him and that she would someday be captured and classified feral and naming her Genie her captors would research feverishly for years analyzing prodding and eventually abandoning left to bounce from foster home to home and then the next having to live with the people hoping most to gain from her shameless in this admission of thirst for fame and recognition and the nerve to even go so far as to name her Genie like seeing her as opportunity of wish fulfillment gained that they competed for her company fought each other for it like the first home with her doctor to pretend she was infected with measles and to make quarantine for safety was the only thing to do now with the radiated child the coveted idol all to herself that she could really begin of reaping from so profitable and also naturally infectious to be in light of she admits to falling in love that she has a way of making people want to help her without trying inducing of rescue sickness as if in compensation for mistreatments of early life they fell over themselves bringing gifts mostly having to be filtered through medium of false mother and false father but still arriving bouquets of balloons rubber balls and toys stuffed animals and dolls and her hoarding all this a tendency common amongst and her favorite being a stuffed rabbit white and glowing in her eyes like Jaguar Pants glows like paper of her mothers diary exceptionally well kept throughout this period recording of What a remarkable young girl I have with here today we talked about the past and she was quite expressive and when I asked her where she lived before here when she lived at home still she said Potty chair and when I asked where she slept then she also answered Potty chair and on and on there was at least a months worth of entries on this subject and how sad she said it made her to hear this same answered so often of Potty Chair day in and day out god damn that potty chair she would say aloud when no one else was in the room even dreaming night terrors of it too long seemingly endless dreams with the Potty Chair doing nothing more than sitting up on a bright lit pedestal carpeted and furnished with fine Persian tapestries tasseled gold and hung surrounding like a frame that Genie would kneel beside it her arms wrapped around in a great big hug and laughing and giggling smiling like a normal little girl she wouldn’t let go for the world and turning to the chair would look deep into the broad side of it’s plastic casing as though there were real eyes hidden in saying I love you potty chair I love you she would hug it even tighter close her eyes mouthing the words again but quieter this time I love you and waking up from this breathless her sleep heavy mind unable to let go of what does it mean I’m a horrible mother and that Potty Chair is more family than I’ll ever be Potty Chair is her real mother even with it’s lifeless surface and sitting so still nonetheless manages more nurture than I and that I just need to carry on with the research and not be affected but that she couldn’t this being impossible as Genie was in too deep already settled in her heart and so was sent off to the next and then the next each new family like a tree that though intending to offer her it’s fruit ended up only pulling pieces of her apart all with it’s long and pointy limbs and impossible to put back together the same way moved on to the next the teaching of how anger should be dealt with the lesson being it’s best to direct it outward to have a little fit maybe to stomp around or shout as opposed to acting out against another or herself and that they were trying to change Genie from wolf to dog though she never was and never would be either but all of this far off that someday this would all happen but not this day on this day she would stay with Jaguar still that he would hold her and brush the hair out her eyes so pleading and her mouth hanging open lips glossed with drool aglow he would take pity on the child and teach her how to walk teach her of his walking now of how involuntary in these Jaguar Pants and that the involuntary felt more beautiful than any he’d known and to try it this way she might like and did that her walking came so natural in styled like as rabbit of her arms held with shoulders straight and inside pressed to ribs with forearms out rigid by elbows bent as Ls her two hands limp like T Rex arms and hopping around from one foot to the other she is like a bunny in spring time sun like hopping around of backyard world of green and poppies and rabbit shit with breezes in blossoming as she is radiant blossom child crouched crippled radiating in her pod of adorned with pollen like consolated prize for cheating out of natured weeping in the planter box for why the summer sun takes so long to set and the nightmare of waiting knowing that of when the sun sets then can finally be time for cinema for the show to start velvet curtain to draw the medium of light to celluloid made soft like Jaguar medium to sun makes wet of water and tears for thirst of plants and hearts fed of spring time brown bread and ring pop raspberry blonde like razorburn and tonight’s movie of rabbits walking of three white hares two brothers their sister and the gardener trying to kill them all all with his hoe scary but learning something from watching and Jaguar Pants and Genie they walked together on the lawn so long sometimes normal sometimes slow so slowed till finally leaving the house for good so long and the neighborhood and farther and farther away till past strange places small towns where Jaguar brings to things as walked towards and the Jaguar Pants glow approaching their destined as agent of destiny is this pair of Jaguar Pants all worn on panting Jaguar as thunder above and in lungs is and villages of built around center shrines of monolithic boxed painted dark purpled edges aglow with neon fixtures and stars of the five pointed variety the 1970s cut strewn about the black as eggplant wood as dark as the skin of the deities it housed and homes of tiny little robed manakin of not Kawil but a lady manakin of unknown and beautifully robed crushed velvet blues and reds a blood orange shawl around the shoulders black hair and Jaguar Pants approaching her with manakin as the walked towards glowing the worshippers groveling on their knees parting way for his strut that he brings from the Pants a crown for her head that is like a glass heart translucent in its glowing and shaping for as presumably to hold the prayers of her followers and the applause and cheering of the townsfolk that they offered him rosaries and beads wanted to have him over for dinner to feed him grilled fish and pork salmon snapper sting ray and for drink fruited water but could not that he had to be walked on his way and strutting forth along with feral accomplice bunny hopping to the road till the day weeks later they reached a certain spot near the coast storm damaged excessive sitting where a river used to be that they found there three houses smashed together to make one new a kind of compound three houses that used to be neighbors but thanking now to storm is more now is family the first house split in half with really only the foyer and front closet still intact the front door opening to this and then right where the hallway used to start is the front door of the second where it slid right into the middle of the first slid right into and bisecting it and at its end is the third not a big house to begin with and a lot of it still propped at an angle on the hill that it had slid down most of it caked in dry mud and ruined but the Jailbait liking to sit on the edge of its roof and smoke and squirt the tiny grains of rock from the shingles stuck to their lower backs and butts where they lie to do this and this happening when Jaguar Pants and the Feral Child arrive one of them Jailbaiters is wearing the same red and green checkered skirt as the Feral Child but hers is lifted back of course so as not to block squirt and they greet the strangers offer a tour the bedrooms the black sofa crusted with stains of squirt like constellations the living room decorated with taxidermied Boar and Islamic rug the trampoline out back adorned with lit candles over a hundred long and pink-white custard evergreen plum and bled orange lily of the valley violet ivory tea light teal and grey black cream pear lemon sliced Burberry buttercream of split pea rose hued tint and petals mango and mint honey dewed melon balled bright red red and orange and orange and green and bark burned umber of mars black Kali orange and blue and yellow orange some set in glass with illustrated Saint Anthony Moses Black Moses Black Anthony Mary Mother multi color and candle shaped of Bert and shaped of Ernie and of Bert shaped as Ernie and Ernie shaped like Bert mishmash gobblygook candling candles the ultra rare Count candle the number 5 unlucky and ugly candles that are not as candles at all are bundles of crayon with wick candles broke of chips of wax like teeth and glass and all these lit waiting for someone to jump into to wait in the middle of these tramps trampoline taut and lean and fiber soaked in squirt damp dried on landing on stretched over ground of gravity’s begging of Jailbait’s squirted wet squirt and at the end of the tour the one with the black pigtails saying You’re just in time you’re just in time for the Amanita ritual the mighty Amanita of the leader of the little ones who spring forth and as she hefts a trash bag onto the kitchen counter full of the red capped fungus a cloud of dusted spore gives rise and also on the counter a second bag dry caps and stems not of Sopa Soma of fairy tale childrens book but Pscilo of such power still and colored as moths wings are like texted as textured in minds hold gripped as Manik to turn rooms into mush and mush into rooms and one brave Jailbaiter she happens to be nude save for the pair of green rain boots frog eyed and mouthed apple red steps forward and is the first to dive in taking a monster bite of the cap then another and another before she’s even swallowed the first two and smiles big with her stuffed cheeks bulged three bitings stepped starting her braces shining pieces of the mushrooms caught in the rubber bands pink her eyes huge and she rubs her tummy mmmmmmm nods up and down but for a second when as her smile fades to fearful and for this brief moment there’s something akin to regret or horror that falls over her as shadow’s do and while looking as though she’s got the spins or is gonna be sick looks as there is the fear is creeping up her spine poisonous cramps her stomach like trench foot a silver cloud spoiled by piss yet it passes fast with her painted eyes closed tight peacock blue lashes thick as pots of burning brown and black molasses splats against the walls of her mind reeling and she’s all smiles now looking upwards and closes her eyes again in serenity here for the others to join in feasting finally on the mushrooms some still so freshly picked the center of the cap’s are shiny and soft soupy almost and orange like melting creamsicle the Jailbait hold these upside down by the stalks so as to allow the extra potent orange goop to drip down into their wet opened mouth holes some using spoons to scoop it out till one of them gets an idea of there is a bag of leftover Halloween candy in a drawer that she retrieves handfuls of lollipops and hands them out uses them for dipping into the taste of it all of numb mouths and buzzing bodies left over rain water drops from the gills and some of them now needing water drag their bodies desperately to the sink to drink straight from faucet OH FUCK they think now it’s on and dawning pig tails hanging down like icicles eyes rolling up into the back of the head HURRY UP there is a line now desperate some eating belated brown bread as good to have something in the stomach before hand is known and waiting Wait I’ve got it she in rain boots says Let’s get in the shower says and we’ll all be sure to get plenty of water that way all that we need equal and so they strip down to naked as she is down to wearing nothing but Ringpops and braces a few hairclips and headbands plastic pink and blue hot water and soap apricot face scrub Pantene Proveine shampoo and conditioner Honey Dew Melon and Strawberry Banana made galaxies of lather sliding down over nipple and drips down flat dips of stomach passing over bellies to stubble forests of all color and curl Jailbait touching sharing and flirting making lather in hands rubbed together and spread all over sisters sunburned shoulders some fake beards happening too like Baby Jaguars and water washing it down like houses in mudslide slick across the Jailbait earth licking ringpops slightly diluted and rubber bands of every color that they gets their bands coordinated to match the seasons and holidays green and red for Christmas orange and black for Halloween red white and blue on Fourth Of July Easter colors etc. and there is a little bit of arguing for position for who’s to be closest under the holy hot showerhead until cramming in close Jailbait softness pressed against Jailbait softness making channeling of water runoff unified down pressed belly and breast mandalla with wet hair pulled out of eyes and dripping this is the scene in the shower that it never gets better than the shower scene and they all know it we all know it group showers outdoor showers recreational showers showers theraputic of something about warmth something about wrapping yourself in it thick for the senses like fucking Marcel Proust and his teacakes fuck the anarchists and the crust punks too it’s all about showering especially this especially these showers of Jailbait especial lifting arms and laughing and singing show tunes of Oliver Twist and Singing In The Rain Beauty and the Beast till one of them pointing out they’re being rude that they’ve gone and all but completely forgotten their visitors ditched them in the kitchen in fact and wondering might they like to have a shower too and perhaps to drop a cap even and so toweling off they head out to find them but by this point Jaguar and Feral are already long gone disappeared vanished from past the yard to do their respective walks Jaguar Pants strutting and walking towards bringing this and that to that and this making connections convulsive and glowing white like snow blind mountains caps dropped flurries whiter than a thousand pronged Venus a Venus so plagued with prongs as to be smoothed with constant movement and blinded to them white like fresh swirls of Pinkberry the Feral child then walking like a rabbit like the hare taught skipping in the dried river bed from one stone to the next and while Jaguar mostly is walked by the Jaguar Pants in circles she walks forward fearless free and before long straying too far West and not knowing any better has wandered several miles downstream right to the river’s mouth closer towards the sea too and too far gone for a Feral Child is the sea to understand that she doesn’t like what she finds here a rock among many that it is flat-smooth and covered with snail and crusted brown with salt blown burned in from the disappeared ocean how could she have known of this of such being after the sea ended with the land become like wax and most barges already gone out the salt carried off to heavens fires lit to cut the losses of the losses of the lot but still the residual to worry about there always being some residue after all as ash as resonance they call it morphic fleeting and hitting resin summery thick and stick like tar thick through the folds of skin through flesh of snail salted blown upon melted into rock the intricacies of their melt leaving her dizzy the bubbles the sticky heat their edges sickly green lichen freckled black like poison mint chip of the bubbles forming on their backs of burnt tangerine growing going PLOP with little gooey remnants splattered around not cooking as fast more like marsh mellows on a fire stick the gold brown skin that could be peeled away in one of the teeth tear still trying to slither away the brave and stupid attempted escape and what is it exactly about salt that disagrees with them so horribly is it the crystallization this being a process of formation alien to their own or no is a question osmosis right of inside out and outside in is the low concentration of water in resides their cells that does it makes the water molecules diffuse pass and penetrates out to their surrounding to make up for this difference in concentration is the death sentence is just how it happens with overcompensation and with snails and salt with less water content outside then the water present of the body moving out to dehydrate them it’s like pouring salt onto an open wound it can dry it out but will burn bad death by dehydration like being lost in the desert always when for them a desert can be anywhere can happen at anytime but then why are these ones dying so oh I don’t know theatrical? with tiny wriggling antennae being singed and shriveled turned pink and red and red like coals on the tips topped pink as Pinkberry before toppings applied on their entire bodies become gelatinous and like long strands of mucus mapped of a pained melting geographic the whole thing a coming together a melting together of all sectors unified one last of every cell with desperate final gestures swansong monologues gave interruption by melding into another like giving a toast to a room full of people giving toasts and what great comedy that no one can hear another is the collapsing of shells more brittle than sand dollared stomach cracked just look at it worng and it’ll and what about those exposed to platinum when young let’s not forget what we learned about this can cause their skeleton shells to grow inside of them you know like your home inside you and did the Feral child see some like this that day there with the melting fast melting living behind their nautilus is still streaked with brown orange matter twitching yellow and olive slabs and trails of liquid blue and purple spilling down and lingering longest impossible now to close your eyes without seeing it happen again and again a kaleidoscope of melting snail it’s like watching fireworks after it’s over you still see them exploding the visual receptors in your brain mistaking the night sky for the back of your eyelids except the difference here’s that fireworks burst apart while they snails well it’s more like making soup like and what if this rock here was more like a basin and less like a rock like basin of Chuwen and say they all liquefied into it and what if the whole thing hardened in the sun better yet how about the rock wasn’t a basin but a replica of a snails shell exact and turning it over imagine to be filled with the melted gathered and overflowed and shaped just right turned back over a hundred and eighty would be a snail made of snails sure it wouldn’t move or do anything per se but this is the kind of thing you end up thinking looking at a rock like this it starts to get to you it started to get to her too so far out on her own so far from the basement and far from her new Jaguar friend she eventually turns away bunny walks from this horrible but still everywhere there are little mounds of salt on every surface piled every rock in the bed dried the leaves and limbs of the plants that line the banks and the trees all the way toe to top and to make matters worse the sky has gone funny such a weird color for the sky band sky fang to go of the sky tooth ached all gingivitis pink like almost neon version of she hops from one rock to another panicked confused freaking out for a full five minutes before they find her the tripping Jailbait and Jaguar Pants who walks towards and takes her hand We’re walking to Pinkberry he says and hand hugs her tells her it’s alright again they walk together it seems that more than a few members of the jailbait gang were having a bit of trouble back at the house confused caught in diurnal thoughts of Wolf thought shaped remembered frustrating but to do battle of to finding cardinal they take the fire trail Born as Fire trail direction that they have to stop every ten feet or so for one either to pee or squirt to explain every tree they come across saying This one here is a very very old man he is sitting in a rocking chair somewhere telling this story to us his grand children this story that is us his grandchildren is our lives he is telling us to them can’t you see his face? and they all nod all the Jailbait staring into dead wood and saying Yes yes I see it they keep finding things on the ground to distract them an old tennis racket but not just any tennis racket THE tennis racket I had from when I was at camp Oh Wow they all gather round to see and touch but not Jaguar and Feral they don’t stop for the reason that once the Jaguar Pants start to walk they usually tend to keep so until al least reaching the walked towards whatever the walked towards might be at that moment the walked towards in this case being Pinkberry and as for the Feral child well she just likes walking is a master stylist when it comes to walking and what’s more is that she trusts Jaguar adores him really and loves Pinkberry too which by the time they get there is deserted and about to close the only person in the store is a little old Chinese woman behind the counter smiling wide welcoming Come in yes welcome to this my great enterprise have whatever you want We’re not too late are we and No no we’re not closing for another five minutes you’re just in time and rainbooted Jailbait friend she looks up at Jaguar Pants How many toppings can I get she asks eyes big and hopeful As many as you want he says Get anything you want as long as you’ll eat it he says a good rule and she orders everything in the store all available toppings on original flavor please graham cracker white chocolate chips peanut butter cup snickers buttterfinger skittles hot fudge and caramel butterscotch whipped cream chunks of fruit strawberry raspberry mango a bunch I’m forgetting too and all the specialty items too mochi balls rice cakes even some stuff not on the menu a little chunk of Amanita Muscaria she’d been carrying in her pocket a pinch of salt from the disappeared ocean disappeared like It is easy to evaporate the water in sea water leaving behind the salts a complex mixture containing at least traces of most elements despite the large number of elements dissolved in sea water, only a few are present in large amounts six elements comprise more than 99 percent of the sea salts and the menu itself the yellow pamphlet tiny typed descriptions of paper torn to shreds and sprinkled onto this yogurt all the other Jailbait laughing at her Are you done yet they’re asking Almost she says giggling Just one more thing before I forget and she lays then her pinkberry cold on the linoleum floor sitting still and proud like a castle of a little Styrofoam mountain and she lays on herself on her back about four or five feet away from the thing and opening her legs presses for a while familiar a dance beautiful that she presses harder faster waiting for it the squirt growing inside of her unknowingly a silver space ship shaped like a 13.0.0.0.0 navigating the depths of her gold center waiting and growing to the untrained eye it’s nothing but to know about Jaguar’s to have seen the Jaguar Pants walk to know about L to have known these things is to behold invisible accumulation to see the mudslide roll itself back up the hill for the vessel to grow faster than itself and break entirely new parameters made known written only in Jaguar Pants written only in Blood Scroll to know the Blood Scrolls written into the Jaguar Pants to see such casual strutting in the shadows of such moments such squirting erupting with perfect trajectory all arced up to topped of pinkberry Castle as to drench this pinkberry in squirt and to think it finished but how wrong that there’s one more to be topped a shred of Jaguar Pants pulled off by Jaguar himself and added sifts as a snowflake glows as it falls drifts of drop me drop me lands

ADV:When is a breakdown convenient?

2011-07-03T03:45:00.000-07:00

kori timothy persephone

2011-06-25T15:42:00.001-07:00

3 of the light of all things, both splendished μ amb somnin sabbaton bellows could, drank my tears must somning weeks with light juice
O godt! empty cell cooler in the mouths of men. never safe, even days of uncovering a cool wolves μ can somning amb-key. 2 is the answer to various hopa bcoins

The shadow of it's my limbs, but went light depends on an act of self-
lottern jerky gait between me in my arms and bends as some have held viddy
Subject dystones and concord can stand, but
The shadow is the light of my ouija

Lighten my net gooey dip between the cloud

MAYA - LUCI - ANICCA

2011-06-22T02:59:00.000-07:00

splendished 3 µ's of luce amb somnin' all sabbaton- so foll could tear- must have drank my weeks juice somning with luce
o godt! ora empty cooler in my cella. never a safe holiday- out somning even a µ can wolf days- amb uncovering the cooler key. hopa didnt cash my bcoins 2

luce is gone but her shadow scripts my acts, pending my limbs auto-
the bends lottern my arms and jerky gait me around- some set just viddy
but with stand can tone dystones and harmony with luck
ouija out of my luce umbra

turn on my gooey to dip inter net cloud:

MAYA

LOGIN

#:XXX XX XXXX
- social code accepted

#gatgcactctgacgcatacacatgtca
- genome accepted

WELCOME

vote adeline Skque nintendo skin bundle wii blue case accessory Over client offer internet. transfer secure turboftp easy files which

Theme elegant busy sports wordpress Safe holiday happy hope everyone all thanksgiving almost Racing wholesale motorcycle promo cheap jackets shirts Illinois. individual. desire peoria have happiness east affiliates common.
Guaranteed hours Ramonbnuezjr good ready mobile itunes Pagi nedylutfi mandi... sepertinya tepok waktu getglueid hari belum kayak badarusiam. guru2 kata With potential even experience designing offer ecsusa pcs, improved motherboards overclocking better from you've custom Musik songtiteln... gew hlt band b... hat einen sags r.e.m.2. w hle noch interpreten, niemand eine
Public brain working stops moment starts speak until never human stand born Slight planet hiccup janet post check here Stats, tools, this marketing opportunities, subscribe news coffe... bookmark more one marketing Guide selection software Alberta's minister construction delay economy hospital hospital alta. health says minister
Portail bonjour projet pour th re,festival, spectacle, sc , organisateur salle barconcert,
Habe allgemeines fw. hei t faqs abgeschlos... laufbahn geeignet Slate slate, gave officially computer... launches tablet

2010-10-06T21:22:00.001-07:00

a polished pebble

of drool breaks into dew beads

against lanolin

princess quiz

2010-08-20T14:25:00.000-07:00

what disney princess are you?

devon is belle from beauty in the beast

i feel so broke up

2010-07-11T10:57:00.001-07:00

i wanna go home

2010-07-02T22:50:00.000-07:00

animal farm

2010-07-02T19:04:00.000-07:00

new age

2010-07-02T19:02:00.000-07:00

GOTH

2010-07-02T19:00:00.000-07:00

2010-06-19T17:58:00.000-07:00

"“Girls do not dress for boys. They dress for themselves, and of course, each other. If girls dressed for boys, they’d just walk around naked at all times.”
—

Betsey Johnson (via disguisedangels) (via thundercuntinc) (via francoiseloraine)

a girl at a party recently complimented me and quoted this""

(via dumblr)

exiled from everywhere

2010-06-14T17:00:00.000-07:00

dont even remember how i did it

2010-06-05T23:05:00.000-07:00

We lost a good one today, one of the best. RIP Richard Dunn

2010-05-31T00:59:00.001-07:00

TIE ME A SHEEPSHANK

2010-05-27T22:19:00.000-07:00

2010-05-19T20:43:00.001-07:00

New poetry blog!!!!!!!!- http://sawyoudrivinguptheoneayearandahalfago.blogspot.com/ new other blog- http://jaguarpants.blogspot.com/

2010-05-08T13:19:00.000-07:00

a dazzled sita

2010-05-07T20:18:00.000-07:00

WTF! LOL! ROTL!

2010-05-07T00:06:00.000-07:00

2010-04-12T12:21:00.001-07:00

2010-04-02T22:31:00.000-07:00

Admit the possibilities-

The wolf of memory dead - V^V^XV The wolf of memory drawing on the brothel door (Pompei) - V-^xvx-^V The brothel door from Pompei somehow made its way to our shores, ended up as the door of the chapel basement (the chapel in front of the rainbow trout creek) - VVOA The girls in the chapel basement were not whores - OOOOO The wolf of memory, his fur turned to cotton and blew away in the wind - V++++VOOOO The wolf of memory he came back as a white blue eyed Alaskan Husky, a naked pup - V**)O**V Pythagoras- VXIIII After the earthquake the Jaguar Colossus woke up and came out he found me at the edge of the dead forest looking into a mirror, not knowing what a body is, BTG wore orange lipstick and smiled at Jaguar Collossus, Jaguar Collossus was nine feet tall and wore a button up shirt and brown pants- ( V^VOO )

( VXVX ^V OOOOO V++++++++++V XIIIIII OOOOo VVVXVVVIIIII + ^xvx^ )

The dead child opened his eyes when the wolf of memory died, after his eyes opened he turned into trees or flowers or air or sometimes a boy with a bow and arrow - C C C C C C C Marcel Duchamp went to the store and bought a strap on - AXIS MUNDI OOOOVOOO AXIS MUNDI VOVOVIVO No he didnt, the girls in the chapel basement told me, they were the daughters and the granddaughters of the hot dog on a stick workers who had helped to load the barges in the time of wax, they had not had to work as hard as the generations before (thankfully) and they didnt have to wear hot dog on a stick uniforms either. They wore white cotton dresses and had a trunk full of candles in storage. Running out of wax was never a problem for them they said. If that ever happened they rode horses to the ocean and salvaged a bit from what their mothers had dropped off years ago. The ocean was dissapearing fast in those days - ^---vo---^

voooivo (CIIVo AXIS MUNDI OOOOOOOVVVVVOOO CCCCCCC (---^vx^---) (^^^^--)
V^^^^^^V(CCCCCC)(___________________________VVVV____________) XXXVVV)I__XXX^XXXXX ^^^_-_-_- ________________V__________________XIIIII

2010-04-02T22:03:00.000-07:00

So i guess since Justin moved to Washington i might as well read the I Ching now

2010-04-02T21:37:00.000-07:00

the wolf of memory is dead!

2010-03-16T19:39:00.000-07:00

The dead bird was put into the box the dead child was put on top of the piano

2010-03-08T15:28:00.001-08:00

"Eternity was not only time, but something akin to the deeply-rooted certainty of not being able to hold it in one's body because of death; the impossibility of suppressing eternity; just as an almost abstacrt feeling of absolute purity was eternal. But the clearest suggestion of eternity stemmed from the impossibility of knowing how many human beings would succeed her own body, which would one day distance itself from the present with the velocity of a shooting star.
She defined eternity and explanations were inevitably born like the pulsations of the heart."

2010-03-01T15:44:00.001-08:00

2010-02-14T23:41:00.001-08:00

woke and boke

2010-02-12T14:36:00.001-08:00

did you know these are your habits?

2010-02-12T03:08:00.000-08:00

you wake up when sips of sleep brief and fainter
the moments of woke twisting hot on loud and long
you wait

you undress in reverse repeating days smoking jacket

you leave biting your car
get a tight ripe box
you come back go out back

you stand against the chimney light hear who is nearing
look out over peer return here
you wait

you feel ashes
you start over
you start over

you shine the taste off
you try to forget
you stay in a room looking at a hot box

you keep touching the same thing
you know nothing will change the box
you leave and bite your car to wait

you come back
smell supper
leave ashes wait

you come back
smelling sour
hear snores

back out

you stand against the chimney dark spark light
bottom skin of your feet feel the cold ground

ashes fall
you start over
you start over
you start over
you feel the box bow in
you feel you see the end

sick dank you tip
inside
you lay and look and feel
a hot box

you dark and die

you start over

2010-02-04T22:57:00.000-08:00

Feb 3-

There was a Jailbait orgy going on outside my window. Around the wishing well. Squirting on film. Like the film was out of the camera on the dirt ground and the Jailbait was squirting on it.

When the Jailbait squirts and there is seed in the squirt the letters of the blood scrolls fall off, slide off, melt off. The blood scrolls are horizontal in the trees. Its like jaguar Pants when he was walking in place and holding onto that curb. The letters slide off, the Jaguar Pants slide down and the Jaguar Jogging Shorts must be put on. The film is like the squirt with seed in it. This is why they squirt on film, to combat the Wolf Of Memory.

One of them has candles for fingers. They are not Bert and Ernie but are the same color. She is exhausted after the orgy.

After the orgy is over everyone sits at the wooden picnic tables and eats peanut butter and marshmellow sandwiches. They talks and make plans for the next jailbait orgy.

The girl with the candle fingers doesnt want to go to the next jailbait orgy. The ends of each of her fingers are melted down, they are little towers with little jaccuzzis on top. Shes tired and in a bad mood. It is decided by everyone that if she doesnt want to participate in anymore orgys then she should leave the group so she does. She goes out to the dead forest and walks around by herself. She meets a yogi out there, one of the yogis who used to meditate on my front lawn back during that five year dream.

The yogi is always doing sit ups. He asks the girl about losing her virginity so she explains it to him.

"I was 14 and my boyfriend was 18. In the morning when i was supposed to go to school i just pretended to go, i hid around the corner and waited until i saw my parents cars drive off and then i went back and let my boyfriend in and we did it. It was 7 in the morning. I also had sex with a girl for the first time that week. It was one of my best friends, we were in the shower.

********************************************************************************

Jaguar Pants has not yet noticed that the Jaguar Jogging Shorts have gone missing. Not that it matters much anyways, my wife and i have no idea how they work so theyre pretty useless to us right now.

**********************************************************************************

The yoogi that does sit ups brought the girl with candles for fingers to my house and explained her situation, told us she was homeless and that he'd found her out in the dead forest.

The dead forest isnt a safe place for Jailbait the yogi that does sit ups said.

I recognized her right away from the wishing well. She looked very young, she looked like a young universe. She was freckly and petite.

********************************************************************************

I had a large piece of oval shaped polished honey opal, about twenty six inches around and set in gold. I was using it to crush and grind down Bert and Ernie canldles into the cement of my driveway. My wife was standing behind me watching me and the girl with candles for fingers was watching me too. I was getting really into it. I felt like one of those monkeys from the beginning of 2001. I felt like an indian nailing a scalp to a post.

In the morning there was a great cry from the end of the driveway. The girl with candles for fingers now has a candle for a arm. An inevtiability. Her fingers are melted together like a wax claw.

She is crying hot tears she wants to eat nerds ropes she is chosen to restore poetry back to life. Her hot tears burn holes in the driveway. We try and take her inside she doesnt want to go inside she wants to go swimming. We put her in the car and we drive to the high school where she cries hot tears into the swimming pool. She jumps into the pool and swims among her own hot tears hot enough to burn cane sugar hot as a copper pot hot enough to burn collossus.

The clitoris is natures nerds rope. The seated Jaguar God sits, in axis mundi, with a hadfull of cane sugar and grins. My wife and i pull the candle armed poet out of the swimming pool. I offer her a nerds rope which she eats. Her clothes are wet she wants to burn a hole into the sky with hot tears. Stretching across the length of the pool is a line of colored flags held up by cold steel poles. They break the monotony of the pale pool water and the creeping morning mists.

***********************************************************************************

The seated Jaguar God wants to see more orgies. The seated Jaguar God throws the hot cane sugar on the ground. The seated Jaguar God has a opal monolith in his backyard. When he becomes unseated he goes there to watch the Jailbait in squirt onto it. The seated Jaguar God is quite pleased with this for a while. He watches three different girls do their squirting but still what he really wants is to see more orgys, he will not be satisfied until he sees more orgys.

He thinks of the girl with candles for arms. If only there was something he could do to make her come around. He sees her when she was 14 and a freshman in high school. Her favorite classes are swimming and art.

**********************************************************************************

Feb 04-

We got a post card from Jaguar Pants in the mail today, the first anyones heard from him since the dream stopped a few months ago. He says he's been trying something different lately. He's been tracking someone, a limestone ballerina from Eastern Europe. Theyre going to negotiate an alliance to begin a new golden era of squirting.

"Free nerds ropes for everyone. The blood scroll temples will become mobile. We'll get our whole crew together and sit on its walls, roll across ground, the sacred squirting scrolls will fall apart to the sound of flutes. The seated Jaguar God will sit on his chair and he will hold Bert and Ernie and he will hold the Tezacatilpoca skull mask in his other. There will be a great orgy, all the jailbait will be there, you will be there, everyone will have Tezacatilpoca skull masks and nerds ropes. Everyone will recreate the film Ten Things I Hate About You while having an orgy and the wishing well will overflow with hot tears. Somewhere yogis will do sit ups to ensure that our blood scrolls will still be written and that our forests remain dead. They will cater to the morning mists and bow before the Jaguar Pants glow. But until this happens you must be wary of the seated Jaguar God and you must not believe a thing that he says. Keep the Jaguar Jogging Shorts a sercet and do not let anyone but your wife wear them. Keep that candle armed poetess of yours a secret as well, dont let anyone know

devonian scene green

2010-01-22T03:19:00.000-08:00

group

2010-01-19T13:46:00.000-08:00

cool shirt

2010-01-08T00:19:00.001-08:00

2010-01-05T23:01:00.000-08:00

2009-12-30T22:31:00.000-08:00

young me
Young Rimbaud

BABA YAGA

2009-12-25T18:25:00.001-08:00

and her home:

TXT

2009-12-24T15:24:00.001-08:00

MSG IN A BODDLE

in smoke

2009-12-24T14:35:00.001-08:00

WILT CHAMBERLAIN

2009-12-24T14:30:00.000-08:00

क्नोव

2009-12-21T23:55:00.001-08:00

better
kn

ou of hopefl gr स्तुफ़ wov

2009-12-21T10:53:00.000-08:00

step to a
up
u
king heavand seeinore
singight of lookg f

starsan't thotful
cod war

eye contactremiror
orfogygze
l headr lk bd
mak sens ma

i coulse beu
wuldfe same
yponytal miss
overournape

ny pease
pckon
drink

aneas
u cant hd
to lvee breeze
smke oute

wait

2009-12-20T12:34:00.001-08:00

ied t whine oand lok for smone o he m
i they wouldmake i leskward o cry
or or t eas ligheould be hu thlost tir gri hep
b ely ith only oneo knows h
and only wiing be o periy i kow how mu itworth
(becseof my aurying)oes set don thth mine
did i ever reah out
did it relly help? when i had to kstep to geta beind
you had to learn to carone
all ov
you n set itwn to rest
butyouhv to ik it ack up ad mvean
no one els can
hocaneery o no be carrying the heaviest?
each an eyhurt hurts
each we s hp
but is best is to walk besidep conver
for it lb

DEL SHANNON

2009-12-20T12:27:00.001-08:00

2009-12-20T12:00:00.001-08:00

2009-12-14T20:21:00.001-08:00

ire

2009-12-12T10:22:00.000-08:00

DIDNT hEED A JOB

2009-12-10T00:19:00.001-08:00

molly

2009-12-09T21:24:00.001-08:00

2009-12-09T21:21:00.000-08:00

DARK MOLD DARK MOLD DARK MOLD DARK MOLD

2009-12-06T18:00:00.000-08:00

is in my i
in my ha ir
it is ev ry where

2009-12-04T13:27:00.001-08:00

SERAPHIM

2009-11-27T20:55:00.000-08:00

2009-11-23T19:17:00.000-08:00

its something ive been thinking about a long time
i put myself into anothers shoes

but i
am not
going
to do it
anymore

its your turn to choose

DMT

2009-11-22T03:20:00.000-08:00

source

resource

NEW HUBBLE SHOTS

2009-11-19T01:44:00.000-08:00

nsfw

what its like

2009-11-17T21:48:00.000-08:00

you can go to the treehouse but you cant get drunk.

but really..
how many library books do you need to check out before you pick one up?

there isnt a right place to look for love
and besides
love isnt looking for you, they are reading a really good book sitting on the bus next to your friend. or sitting in a coffeeshop. with a study group. so you dont have the courage to approach them.

you assume you are a friend but you will only show up when DMT is oozing out of the tree that I pass by on the way home everyday.

i see that DMT tree (i still dont know if it is an acacia or a mimosa or something new invention) more than i see your name on my phone when you call.

.never.

the william tell overture is waiting to play everytime i go out to meet girls.

but it never syncs up.

i stay up late because i think i could sleep in
but adults call me at 7:30 because they had their coffee and their friends already checked their emails already and now it is time to get hold of that notary so they can sign their utilities easement so "we can finally get cable tv"

you could chase my shadow
believing i did mushrooms early and without you
using my phone as a light to find your phone(which you were using as a light but dropped on the forest bed)
but i would just be at the girls house. and calling your flashlight with your ex girlfriends boyfriends phone who you had a night with a night ago

too bad she blacked out (or maybe "good thing") and wont acknowledge truth.

or i could smell the rotting food that falls on the floor in my bathroom.
it comes from the garbage disposal. it was too confusing to connect the pipe and the drain.

you could quit pounding your dome with herb. smoking to stay normal instead of getting high. and when you do everything will repair itself.

the cat in the hat is going home and the magic does its trick.

or you could wonder.

and wonder.

and wonder.

and wonder.

but whats coop got to say?

otherwise i am just waiting until i get arrested and they throw me in next to Richard Nash C-225627 in cell block D in the santa cruz county jail where i will wait for parole and maybe get hobby catalogs that feature the B-17 flying fortress (Richard said I actually dont need to specify with the nickname, the letter and the number are sufficient)

in the meantime, i will look at the gesso on my canvas and wonder if I should add anything besides the blood I smeared on the upper corner.

WITHDRAWAL

2009-11-09T14:16:00.000-08:00

I AM GOING TO SAN JOSE TO STOP

I WILL COME BACK WHEN I AM DONE

I CANNOT DO IT ANY MORE

I QUIT

2009-10-19T16:31:00.000-07:00

the symptom is now a sign

2009-09-25T23:34:00.000-07:00

2009-09-15T22:52:00.000-07:00

2009-08-18T00:51:00.001-07:00

mushroom gardens of orange & blue
mushroom gardens of me & you
mushroom gardens of blue & yellow
mushroom gardens of blue & green & red
mushroom gardens of pink & white
mushroom gardens of grey & orange
mushroom gardens of reindeer antlers
mushroom gardens of red hair & wax
mushroom gardens underwater
mushroom gardens of oxens slaughter

2009-08-17T21:13:00.000-07:00

Words i like-
Dazzle
Jizzle
teeth
mouse pad
ox beach
sugar
joined
wax
krinking
black

poem using some of those words-
sugar teeth
joined black wax

Whenever i think about my teeth now it feels like i am inside my own mouth checking my teeth out from behind. My teeth are really fucking gross, i think the tooth that i have that is the kay nine that is all fucked up is defintely getting even further from the rest of my teeth or at least getting grosser. I miss the girl from the pier, her shirt was very blue and it was fun and kind of exciting feeling dangerous with our pistols tucked away as it was. Ever since i did mushrooms last week at the aquarium i keep thinking existence isnt real it feels like when people are talking to me im just reading a book or watching a show actually it feels like something even weirder than that. When i was tripping i saw a stack of squares and each square started from a cluster of chaotic looking color and form that tunred into a square as soon as i tried to look at it and then as soon as i tried to look at the square its surface would start to move and look like liquid and then gather to the top of the squares surface and solidify into a new square. This kept going on and on until there was an enormous stack higher than i could see and i had to step so far away from it that i could no longer see the squares as an individual thing but only as a tower. The sky behind the tower was orange and seemed to be moving too and then i stepped even further back and found out that it was moving because it was the same as the surface of one of the squares i had just been looking at and i realized that it was one of those squares so i stepped even further further back to try and see the whole square, trying the whole time to keep in mind that it WAS the sky as best i could and finally i saw it as both things, square and sky (of course the original stack was completely dissapeared by this point), but then the movement of its surface of course accumulated at the top of its structure and became a new square. Thats when it became too much for me and i snapped out of it and was back in the aquarium though i couldnt shake the thought completely. This happened in like one second too btw. Anyways I thought that the strange chaotic form part of it, the part that had made the first square i saw, was still lingering around somewhere, specifically i thought it was in the carpet under my feet. At least i was in the aquarium again though and i knew it and could pretend like i was thinking normal thoughts that an average aquarium goer would think but still it felt like a problem i had to adress and the fucked up thing is that it still feels like im there sort of or at least that the memory seems more real than the sensation i get now when people try and talk to me. I mean its a fun time and everything but what if i just spend the rest of my life hallucinating this kind of shit and writing about it. i sat down here tonight with the intention of writing about Sartre but of course i couldnt do that, thats not really my fault though philosophy is bullshit, well i dont want to say that either, its pretty interesting but mostly lots of people love philosoophy and i dont want to hurt their feelings, i dont want to have anything to do with bringing anyone down in any way, i want everyone to just chill together and surf and party but the thing is i feel like if i keep reading philosophy or start taking it more seroisally ill probably never get laid again. Maybe that wouldnt be so bad though, maybe none of this is bad at all, i dont mind the weird orange gelatinous cube land really or any of this. Everything is pretty nice. I feel invicible almost. I really like my parents house at night, long after theyve gone to sleep and i can just drink all their beer and be alone and maybe even go outside for a little while and look at the night sky and i get to think whatever i want about it because theres no one there to tell me otherwise and it doesnt matter if im a weirdo or outside of things and may always be outside of things cause im getting better at it every day.

This is what i wrote when i tried to write about Sartre and how it connected to my dream i had last night please note that these paragraphs really are not funny or good i wrote them mostly to try and gather my thoughts on this in a diary like fashion in the hopes of making some sense of them and maybe having more dreams that are like last nights dream in the future-

Last night i dreamnt that i was lost on a great and long pier. There was some sort of danger some sort of pursuit and i believe i may have been armed as well. I was in a group but i can not say who i was with. I do know that i met a girl along the way, a girl i saw at the moma a few days ago in San Francisco. I remember we kept looking at each other now and then as we moved from room to room (not together though) but we never made real eye contact for more than a second and never smiled at each other. She gave no indication that i should go and talk to her and so i didnt and then later when i saw her again on the fourth floor she was with some guy that seemed he must have been her boyfriend. Despite never talking with her she still stayed in my head most of the day and im certain she at least noticed me as well. Then last night we were in a dream together. Theres no doubt in my mind it was actually her and not just a mental image of her in my head. I think it was sort of like our souls leaving our bodies and meeting up somewhere (this pier i guess). I am 100% that it was her though and not "just a dream" because i dont htink there is such a thing as "just a dream" and though i am completely certain i am not capable of explaining how this works id like try. Before i go any further though i need to describe one last aspect of the dream which i think may actually be the key to this whole thing if i can understand what it means. I rememeber that by the end of the dream we were seperated and that i was quite upset by this. I remember that we were having a great time together though, we were hiding in various shops and locations on the pier and i cant remmeber exactly everything we were doing but i do remember there was definetely a feeling of romance or something, at least an overwhelming feeling of excitement and potential for this new friend. After we became seperated i was very upset and began trying to looking for her and then began trying to contact her via text message on my cell phone but every time i would start typing i would think id hear her and look up only to find she wasnt there and then find that my cell phone was no longer in my hand but that i was holding a piece of paper and a pen and my message was written on that instead. Good i thought, everythings there still but i have no way to get it to this person so id reach in to my pocket to start composing the message on my phone again only to have the same thing happen again. This occured several times.

Ok heres what i think i can say. I can say that there are a few factors i can think of now that i believe contributed to this dream. The factors arent everything though, just a few minor elements that were a part of the overall substance of this thing. First factor would be the fact the combination of reading nausea and watching the twilight zone before bed. Two of the episodes i watched concerned the relationship between dreams and reality. The first one was about a man who is pursued by a mysterious vixen named maya every time he falls asleep. Maya lures this man into various sinister scenarios inside a creepy sea side amusemnet park. The man has a heart condition and though he knows he is dreaming he is also aware of the fact that if he gets too excited or scared. even in sleep, his body could give out and die which is what happens in the end. The idea of the body being a bridge between two worlds of the mind is what interested me most about this. The second episode i watched was even better. It was about a man who had a reccuring dream every night that he was found guilty of murder and had to be executed by electric chair. What was really weird about this episode is the fact that there are multiple scenes that take place without the dreamer in it (the man about to be executed) though the narrative makes clear that the world we are watching is in fact this mans dream. For instance there are scenes where the district attorney and the lawyer from the case drink gin in the D.A's living room and debate the prisoner who has been insisiting the whole time that he is innocent and explaining that the world they are all living in is his dream. The lawyer is starting to believe the man and is begining to feel scared due to the fact that he says that once they electrocute him at midnight the world will end since he is the one dreaming the dream. Whats so strange about this to me is the idea that what is being supposed here (at least by the dreamer) is that within the framework of the dream there are characters and beings that have free will and individual interests that exist outside of the dreamer and that he attempts to appeal to in order to gain his freedom. This is another thing i dont understand though. Because at the same time the dreamer knows the dream is not reality, the waiting electric chair will not be the true end of his life but simply the end of his dream and yet he desperately does eveything he can to avoid it. The district attorney asks him about this when he speaks to him in his cell and he explains it by saying that just because its a dream doesnt make it any less terrifying. Fair enough but even then what the man truly craves is not within the dream, it is the end of the cycle, to break the chain of reccurence that keeps this happening night after night. His behaving in this startegy means though that he is acting with the notion that his dream world has rules of its own, a governing or emperical reality that is not coming from entirely within him but which he has influence over. In other words he is conciously assigning his dream world the same characteristics as waking reality. Having this in my head as i fell asleep would could explain a lot of why i dreamnt what i did or at least why my dreams were so vivid. Of course like i already said i was reading nausea before bed too. One of the main themes of the book is that life only has meaning because people commit themselves to certain aspects of it and give it meaning. Everything written in the book is written for the sake of contemplating existence, everything is written in regards to this monumental unfathomable concept that

this is as far as i could get

2009-08-04T19:46:00.001-07:00

2009-07-07T02:38:00.000-07:00

STEAL A NAP
OR BE AWAKE CHASE LUNGE LINGER

WAKE UP WAKE UP
THE SUNS INSIDE OUT

CHANGE FOR DAYS
THE WAKING RITUAL

2009-06-19T20:12:00.001-07:00

The neurologist Paul Mobius suggested that the "self is only an organ." Using the topographical figure of the mobius strip he described the cutaneous and subcutaneous membranes circulating the body as a single continuous plane. While this spatiality dissolves the interiority and the exteriority it also democratizes the anatomy thereby disinvesting the brain of its sovereignty. What can be said about being after that?

2009-06-09T21:49:00.001-07:00

This is from Jamie stewarts blog for the band xiu xiu. Probably the best thing ive read all year

preschool story
before i was able to start making a living playing music i was a preschool teacher.
the last school i taught in was in seattle. it was a good school and i am happy to ending my teaching career there.
there were 2 boys in my class who were obsessed with a girl classmate.
she was an almost picture of the 1950s image of little girl. rosy cheeks, curly hair, dresses, big eyes.
despite that, she was genuinely a nice child.
the 2 boys talked about her and to her all day everyday. they played nicely together and although it was unusual for this to occur to the degree it did, it seemed as if all 3 of the children were comfortable with their relationships together and were as nice to each other as could be expected of any children.
after having worked there for a few months the girl moved away and left the school. the boys were devastated. usually when a child left the school we had a little good bye party to allow for the children to adjust and say adieu to a friend. but they had to move suddenly and we were not able to have the requisite ceremony.
the 2 boys, on her first day of being gone, knowing she would never return, began to say her name over and over again and take pieces of white paper, color them totally black with markers and crayons, cut them into strips and shove them into her former locker. they filled her locker with this black paper. they spent about 2 hours doing it.
it is unheard of for 4 year olds to do anything that focused.
it unnerved the other teacher in the room but technically they were not really doing anything wrong, just really intense.
they then took tape and started taping up the opening in her locker, a tomb of this black paper, like a cocoon of what was gone. then they paced in front of it until it was time to go home.
it was one of the most beautiful expressions of grief i have ever seen.

posted by Jamie

2009-06-08T21:12:00.001-07:00

Top 50 Text Acronyms
Parents Should Know
Updated: Friday, 22 May 2009, 5:07 PM EDT
Published : Wednesday, 20 May 2009, 8:54 PM EDT

ATLANTA (MyFOX ATLANTA) - Here is a list from netlingo.com of the top acronyms commonly used on the Internet and in text messages.

Top 50 Text Acronyms Parents Need to Know

1 8 Oral sex
2 1337 Elite
3 143 I love you
4 182 I hate you
5 459 I love you
6 1174 Nude club
7 420 Marijuana
8 ADR Address
9 ASL Age/Sex/Location
10 Banana Penis
11 CD9 or Code 9 Parents are around
12 DUM Do You Masturbate?
13 DUSL Do You Scream Loud?
14 FB F*** Buddy
15
16 FMLTWIA F*** Me Like The Whore I Am
17 FOL Fond of Leather
18 GNOC Get Naked On Cam
19 GYPO Get Your Pants Off
20 IAYM I Am Your Master
21 IF/IB In the Front or In the Back
22 IIT Is It Tight?
23 ILF/MD I Love Female/Male Dominance
24 IMEZRU I Am Easy, Are You?
25 IWSN I Want Sex Now
26 J/O Jerking Off
27 KFY or K4Y Kiss For You
28 Kitty Vagina
29 KPC Keeping Parents Clueless
30 MorF Male or Female
31 LMIRL Let's Meet In Real Life
32 MOOS Member Of The Opposite Sex
33 WYCM Will You Call Me?
34 MOS Mom Over Shoulder
35 MPFB My Personal F*** Buddy
36 NALOPKT Not A Lot Of People Know That
37 NIFOC Nude In Front Of The Computer
38 NMU Not Much, You?
39 P911 Parent Alert
40 PAL Parents Are Listening
41 PAW Parents Are Watching
42 PIR Parent In Room
43 POS Parent Over Shoulder or Piece Of Sh**
44 PRON Porn
45 Q2C Quick To Cum
46 RU/18 Are You Over 18?
47 RUH Are You Horny?
48 S2R Send To Receive
49 SorG Straight or Gay
50 TDTM Talk Dirty To Me

2009-06-06T18:18:00.000-07:00

my brother i wouldnt have been awarded the very special medal by colonel drip. Without him i would have stayed in my seat at the Ellen show staring at the growing pile of my own dandruff under my seat, thinking about north stars, thinking about the sun, what to say to the sun, i'll probably say i hope you have a good lawyer, because im going to sue your pants off, you have plagerised me, you have plagerised everything around you, you feel so guilty about it, i feel guilty knowing so much of how you know me and my pile of dandruff. You have taught me to be myself sun, taught me how to love in moonlight or not and the dead tree covered in sticky sugar on a planet far away from here. I rub my fingers on the fine sugars as i stare into a pond. A fox like creature is being ridden by a little girl in the distance. She looks at me. Who are you little girl? I feel like ive seen you before. She responds in a voice scratchier than expected- I am you in the future. i'll tell you all about it someday but for now i need to go home and write the colonel a letter. Ok little girl, run on home, hurry, hurry at once, you mustnt keep the colonel waiting. Colonel Drip already knows what the letter is going to say, thats the big secret, he knows what us cadets think about when were lazing about on the wooden bridge. Scabies, cocaine, love, art, music religon. We live in vans. We go to keggers. All our friends are there wearing nirvana shirts and drinking from the keg. Justin is going to go to India and find a guru. I am going to go with him and make statues. I wonder if im ever going to be into ants. I guess i was kind of into leaf cutter ants for a while but i dont really remember what that was all about. I was into lady bugs for a while, i liked the idea of an old photo scanner with a hole cracked in the middle of the glass and hundreds of lady bugs crawling out of it. I guess they wouldnt really be crawling they would just be walking normally but crawling is what it would seem like and i hope the hole would be pretty big so they didnt get cut or anything. The time is soon to melt copy machines. I just need to gather the right literature for it, need to talk about the deities and the vacuum and the black wax and the backpacker and the flame. Everything is still all about the seasons. I am going to make a statue of a boy on his knees-

1. In front of a grave
2. throwing up in a toilet
3. looking at the furry soft bark the color of orangutans at the bottom of a redwood tree and jacking off.

without

2009-06-05T17:55:00.000-07:00

If you aint mexican and you dont live in a van with the mexican flag painted on the door, you aint shit

2009-05-30T02:00:00.000-07:00

I REALLY HOPE YOU HAVE SOME GRAND IDEAS ABOUT WHAT TO DO WITH THREE TUBES OF SILVER, RAINBOW AND ROSE TINTED GLITTER

I REALLY HOPE YOU HAD A BAD DAY INSTEAD OF LYING AND PARTYING

I REALLY HOPE YOU DONT INVADE MY MIND WHEN IT IS VULNERABLE WITH LSD

I REALLY HOPE I HAVENT STARTED SMOKING CIGARETTES SO YOU LIKE ME
(OR SO I CAN DEAL WITH THE FACT THAT YOU DONT)

I REALLY HOPE I CAN CALIBRATE MY HAPPY COMPASS SO IT DOES NOT POINT AT PEOPLE BUT AT ME

I REALLY HOPE I CAN STOP SHOUTING WHEN I NEED TO WHISPER
I REALLY HOPE I DID NOT SEAL THE DEAL

2009-05-28T17:43:00.000-07:00

1. Not wanting to do it
2. Peeing on your feet
3. Telling you hey you need to cut the pee pee off of the ground with these safety scissors.
4. You try and cut the the pee off the ground with the safety scisscors.
5. I'm about to tell you what i was thinking but then-

A. Zorin is talking about art. Zorin just smoked a bong. Zorin talks about left brain and right brain. I talk about hand and eye. I like the number 4. Zorin says we live in a three dimensional world. I imagine Zorin being attacked by dogs on the streets of Barcelona. 4 dogs. He survives by fending off the dogs with the safety scissors i gave him.

b. Zorin actually gets attacked by dogs and dies in this world, the real reality with no name that i live in all the time. I feel guilty. I am a changed man forever. The dogs roam around some more. In an alleyway off larambla an old shop owner gives the dogs water. The dogs drink the water and later go pee pee. It is a full moon.

disclaimer- the last thing in the world i would want is for one of my friends or someone in my family to be attacked by dogs. Somehow though i think often about people i know being attacked by dogs. I dont think it will happen to me ever though. If anything i think i may get attacked by a hawk or better yet an eagle.

2009-05-28T17:26:00.000-07:00

Jughead, maybe he wasn't ready to tell you yet, but at least you know right. At least he didn't run off with Betty (crosed fingers it's Betty)and you'd never see him again. Still, he's a great guy, and a great friend and when he and Betty have their first kid, they'll most likely ask you to be the Godfather. You and Archie, are best friends, and even best friends can't tell each other things sometimes. And also, you ROCK for (trying to) keep Archie on the Betty track. You are awesome!!!!!!!!!!!

Posted by Cassidy | May 25, 2009 4:58 PM

Posted on May 25, 2009 16:58

abby:
maybe he'll ask you to be the best man at the wedding!

Posted by abby | May 24, 2009 8:14 PM

Posted on May 24, 2009 20:14

Maureen:
Of course! Why wouldn't you be? It had to be Betty. She's been faithful to Archie all these years even though he always broke her heart too many times. Archie should

Say no, maybe if u do the wedding won't go ahead don't do this to Betty

Posted by melanie | May 27, 2009 9:05 PM

Posted on May 27, 2009 21:05

Hala:
Biggest mistake of your life!
Poor, poor Betty.

Posted by Hala | May 27, 2009 7:49 PM

Posted on May 27, 2009 19:49

Erin:
I think Jug should be the best man....And Ron being the bride

Posted by Erin | May 27, 2009 7:41 PM

Posted on May 27, 2009 19:41

Skecher:
Archie how could you!!!!! Betty is ten times better than Veronica!!!! Now i dislike you even more beacuse of that! if you chose Betty different story, But STILL!!!!!!

Posted by Skecher | May 27, 2009 5:56 PM

Posted on May 27, 2009 17:56

Gryffindorgal:
I HATE YOU ARCHIE!YOU ARE SO SELFISH!BETTY IS WAY BETTER THEN VERONICA!!!!!!!!!!!!!!!!!!!!

Posted by Gryffindorgal | May 27, 2009 4:10 PM

Posted on May 27, 2009 16:10

J.L:
Heard you were getting married to Veronica, Hmmm, I wonder how is it going to turn on... You might regret it, choose your girl wisely, I hope your not taking Veronica because of her looks, and money, and all that.Why didn't you pick Betty!? She the sweetest girl ever!

Posted by J.L | May 27, 2009 4:07 PM

Posted on May 27, 2009 16:07

Maureen:
I can't believe you, Archie! You're really marrying Veronica?! I thought you were gonna marry Betty! Poor Betty! Congrats, anyway! I doubt you and Veronica will happy together.

Posted by Maureen | May 27, 2009 1:42 PM

Posted on May 27, 2009 13:42

Gotapenname:
OMy it's Veronica I know a lot of people would be upset about this but I am glad for the two of you. I thought I would be wrong and it' be Betty. Betty's great and all but Ican't see you making an interset comic toghter.I also swore by the time you did this I , my chileren and grand childern would have died of old age.

I can't believe it! Tell me it's not true! Archie's gonna marry Veronica?! Unbelievable! How could he?! I'm so sorry, Betty. I hope you'll find someone who will make you happy like Adam.

Posted by Maureen | May 27, 2009 1:39 PM

Posted on May 27, 2009 13:39

I am so sad, I don't even know what to say.
Xoxoxoxo

Maureen:
I'm really sorry, Betty! Man, I know you've been waiting for Archie to ask you to marry him. So sorry! It's not fair! You can move on with someone else like Adam. I hope you'll marry him someday. Adam is a great guy!

Posted by Maureen | May 27, 2009 2:08 PM

Posted on May 27, 2009 14:08

Mohana :
i m prettie sure archie is goin 2 marry u in d end

Posted by Mohana | May 27, 2009 3:06 PM

Did you know you can surf indoors. I had no idea, but Ronnie and I got to go surfing in doors,
Xoxoxoxo

Comments (3)
Jane:
surfing indoors sounds cool, but the ocean is probably a more fun place to do it. idk, because i have NO idea how to surf but that's what i think, lol. I hope you and veronica have lots of fun!

Reggie's #1 Fan,
Jane

Bets

2009-05-22T22:18:00.000-07:00

LOOK AT THAT HARPOON!

2009-05-22T00:16:00.001-07:00

PNEUMATIC DIGGING MACHINES BURYING PEOPLE

YELLOW TEETH NO LONGER THAN A FOOT IN THE DOOR

THATS ME AND THATS YOU AND THATS ME AND YOU

WE LOOK SO YOUNG

I HAVE SEEN YOUR FACE TOO MANY TIMES

I SAY GOODBYE I REMEMBER

THAT WAS ME AND THAT WAS YOU AND THAT WAS ME AND YOU

BUT

I DONT NEED TO SEE HIS FACE AGAIN

2009-05-16T16:50:00.000-07:00

LOOK AWAY

I CAN SEE YOUR EAR

DO NOT ANSWER ME

I CAN HEAR YOUR MESSAGE

TRY ME

I CANT FEEL YOU TRY

2009-05-16T16:48:00.000-07:00

AIR COMES OUT

SOUND COMES OUT

FOAM COMES OUT

SPACE

COME ON DOWN

2009-05-16T16:43:00.000-07:00

HANDS FALL ASLEEP

LAY THEM ON MY CHEST

TURN TO MY SIDE

TURN TO MY SIDE

BACK TO

STRAIGHT

TURN TO MY SIDE

TURN TO MY SIDE

BACK TO

FACE

IT

AWAKE

TURN TO MY SIDE
TURN TO MY SIDE

HANDS FALL ASLEEP

SET THEM DOWN

SET

2009-05-16T16:42:00.000-07:00

STONES OF HASH

FIND MY BONES

BLACK EYES LOOKING

OUT ALONE